ID: 1015544616

View in Genome Browser
Species Human (GRCh38)
Location 6:134348638-134348660
Sequence CCAATACATGCTGACAAAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015544612_1015544616 -5 Left 1015544612 6:134348620-134348642 CCTTCTGAGGCCCTTTCTCCAAT No data
Right 1015544616 6:134348638-134348660 CCAATACATGCTGACAAAATCGG No data
1015544608_1015544616 3 Left 1015544608 6:134348612-134348634 CCCCATGCCCTTCTGAGGCCCTT No data
Right 1015544616 6:134348638-134348660 CCAATACATGCTGACAAAATCGG No data
1015544605_1015544616 29 Left 1015544605 6:134348586-134348608 CCGCTCATGGTTAAGCTTGGAGC No data
Right 1015544616 6:134348638-134348660 CCAATACATGCTGACAAAATCGG No data
1015544607_1015544616 7 Left 1015544607 6:134348608-134348630 CCTGCCCCATGCCCTTCTGAGGC No data
Right 1015544616 6:134348638-134348660 CCAATACATGCTGACAAAATCGG No data
1015544611_1015544616 -4 Left 1015544611 6:134348619-134348641 CCCTTCTGAGGCCCTTTCTCCAA No data
Right 1015544616 6:134348638-134348660 CCAATACATGCTGACAAAATCGG No data
1015544609_1015544616 2 Left 1015544609 6:134348613-134348635 CCCATGCCCTTCTGAGGCCCTTT No data
Right 1015544616 6:134348638-134348660 CCAATACATGCTGACAAAATCGG No data
1015544610_1015544616 1 Left 1015544610 6:134348614-134348636 CCATGCCCTTCTGAGGCCCTTTC No data
Right 1015544616 6:134348638-134348660 CCAATACATGCTGACAAAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015544616 Original CRISPR CCAATACATGCTGACAAAAT CGG Intergenic
No off target data available for this crispr