ID: 1015545460

View in Genome Browser
Species Human (GRCh38)
Location 6:134356895-134356917
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015545457_1015545460 0 Left 1015545457 6:134356872-134356894 CCTTCATTTATTCAATCAATCAT No data
Right 1015545460 6:134356895-134356917 CTTTTCACAGACATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015545460 Original CRISPR CTTTTCACAGACATGGAGCT GGG Intergenic
No off target data available for this crispr