ID: 1015546430

View in Genome Browser
Species Human (GRCh38)
Location 6:134366502-134366524
Sequence TTGCAGAAGCTCCACCATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015546430_1015546433 0 Left 1015546430 6:134366502-134366524 CCAAAATGGTGGAGCTTCTGCAA No data
Right 1015546433 6:134366525-134366547 GTGGAGCCATCTCAAGTCAAGGG No data
1015546430_1015546434 4 Left 1015546430 6:134366502-134366524 CCAAAATGGTGGAGCTTCTGCAA No data
Right 1015546434 6:134366529-134366551 AGCCATCTCAAGTCAAGGGATGG No data
1015546430_1015546432 -1 Left 1015546430 6:134366502-134366524 CCAAAATGGTGGAGCTTCTGCAA No data
Right 1015546432 6:134366524-134366546 AGTGGAGCCATCTCAAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015546430 Original CRISPR TTGCAGAAGCTCCACCATTT TGG (reversed) Intergenic
No off target data available for this crispr