ID: 1015546432

View in Genome Browser
Species Human (GRCh38)
Location 6:134366524-134366546
Sequence AGTGGAGCCATCTCAAGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015546429_1015546432 0 Left 1015546429 6:134366501-134366523 CCCAAAATGGTGGAGCTTCTGCA No data
Right 1015546432 6:134366524-134366546 AGTGGAGCCATCTCAAGTCAAGG No data
1015546424_1015546432 24 Left 1015546424 6:134366477-134366499 CCCTCATTTGTAACTATGACCTT No data
Right 1015546432 6:134366524-134366546 AGTGGAGCCATCTCAAGTCAAGG No data
1015546425_1015546432 23 Left 1015546425 6:134366478-134366500 CCTCATTTGTAACTATGACCTTG No data
Right 1015546432 6:134366524-134366546 AGTGGAGCCATCTCAAGTCAAGG No data
1015546430_1015546432 -1 Left 1015546430 6:134366502-134366524 CCAAAATGGTGGAGCTTCTGCAA No data
Right 1015546432 6:134366524-134366546 AGTGGAGCCATCTCAAGTCAAGG No data
1015546428_1015546432 5 Left 1015546428 6:134366496-134366518 CCTTGCCCAAAATGGTGGAGCTT No data
Right 1015546432 6:134366524-134366546 AGTGGAGCCATCTCAAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015546432 Original CRISPR AGTGGAGCCATCTCAAGTCA AGG Intergenic
No off target data available for this crispr