ID: 1015547960

View in Genome Browser
Species Human (GRCh38)
Location 6:134381209-134381231
Sequence CAGGCTCAGCACTCTTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015547960_1015547966 21 Left 1015547960 6:134381209-134381231 CCTCCAAAAGAGTGCTGAGCCTG No data
Right 1015547966 6:134381253-134381275 CACATGGATATGTAGCACCTTGG No data
1015547960_1015547962 -5 Left 1015547960 6:134381209-134381231 CCTCCAAAAGAGTGCTGAGCCTG No data
Right 1015547962 6:134381227-134381249 GCCTGAAAACTTGAGATTTGAGG No data
1015547960_1015547964 5 Left 1015547960 6:134381209-134381231 CCTCCAAAAGAGTGCTGAGCCTG No data
Right 1015547964 6:134381237-134381259 TTGAGATTTGAGGCACCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015547960 Original CRISPR CAGGCTCAGCACTCTTTTGG AGG (reversed) Intergenic
No off target data available for this crispr