ID: 1015547962

View in Genome Browser
Species Human (GRCh38)
Location 6:134381227-134381249
Sequence GCCTGAAAACTTGAGATTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015547961_1015547962 -8 Left 1015547961 6:134381212-134381234 CCAAAAGAGTGCTGAGCCTGAAA No data
Right 1015547962 6:134381227-134381249 GCCTGAAAACTTGAGATTTGAGG No data
1015547959_1015547962 24 Left 1015547959 6:134381180-134381202 CCGTAGCAAAAGCAGCTACTGTA No data
Right 1015547962 6:134381227-134381249 GCCTGAAAACTTGAGATTTGAGG No data
1015547960_1015547962 -5 Left 1015547960 6:134381209-134381231 CCTCCAAAAGAGTGCTGAGCCTG No data
Right 1015547962 6:134381227-134381249 GCCTGAAAACTTGAGATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015547962 Original CRISPR GCCTGAAAACTTGAGATTTG AGG Intergenic
No off target data available for this crispr