ID: 1015547966

View in Genome Browser
Species Human (GRCh38)
Location 6:134381253-134381275
Sequence CACATGGATATGTAGCACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015547961_1015547966 18 Left 1015547961 6:134381212-134381234 CCAAAAGAGTGCTGAGCCTGAAA No data
Right 1015547966 6:134381253-134381275 CACATGGATATGTAGCACCTTGG No data
1015547960_1015547966 21 Left 1015547960 6:134381209-134381231 CCTCCAAAAGAGTGCTGAGCCTG No data
Right 1015547966 6:134381253-134381275 CACATGGATATGTAGCACCTTGG No data
1015547963_1015547966 2 Left 1015547963 6:134381228-134381250 CCTGAAAACTTGAGATTTGAGGC No data
Right 1015547966 6:134381253-134381275 CACATGGATATGTAGCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015547966 Original CRISPR CACATGGATATGTAGCACCT TGG Intergenic
No off target data available for this crispr