ID: 1015549528

View in Genome Browser
Species Human (GRCh38)
Location 6:134397712-134397734
Sequence GTCTCCTAGAAGCTACATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015549528_1015549533 24 Left 1015549528 6:134397712-134397734 CCTAAATGTAGCTTCTAGGAGAC No data
Right 1015549533 6:134397759-134397781 TGATGTTAACTGTGGATCACTGG No data
1015549528_1015549532 16 Left 1015549528 6:134397712-134397734 CCTAAATGTAGCTTCTAGGAGAC No data
Right 1015549532 6:134397751-134397773 AAAGAAAATGATGTTAACTGTGG No data
1015549528_1015549534 25 Left 1015549528 6:134397712-134397734 CCTAAATGTAGCTTCTAGGAGAC No data
Right 1015549534 6:134397760-134397782 GATGTTAACTGTGGATCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015549528 Original CRISPR GTCTCCTAGAAGCTACATTT AGG (reversed) Intergenic
No off target data available for this crispr