ID: 1015554960

View in Genome Browser
Species Human (GRCh38)
Location 6:134451734-134451756
Sequence AGGCAGGGGCCTGGGCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015554960_1015554968 0 Left 1015554960 6:134451734-134451756 CCTGCAGGCCCAGGCCCCTGCCT No data
Right 1015554968 6:134451757-134451779 GCCCAAATGGCTGTAGTCACTGG No data
1015554960_1015554974 7 Left 1015554960 6:134451734-134451756 CCTGCAGGCCCAGGCCCCTGCCT No data
Right 1015554974 6:134451764-134451786 TGGCTGTAGTCACTGGAAGGGGG No data
1015554960_1015554978 25 Left 1015554960 6:134451734-134451756 CCTGCAGGCCCAGGCCCCTGCCT No data
Right 1015554978 6:134451782-134451804 GGGGGTTGGGGAGCAGAGAGTGG No data
1015554960_1015554980 29 Left 1015554960 6:134451734-134451756 CCTGCAGGCCCAGGCCCCTGCCT No data
Right 1015554980 6:134451786-134451808 GTTGGGGAGCAGAGAGTGGAGGG No data
1015554960_1015554979 28 Left 1015554960 6:134451734-134451756 CCTGCAGGCCCAGGCCCCTGCCT No data
Right 1015554979 6:134451785-134451807 GGTTGGGGAGCAGAGAGTGGAGG No data
1015554960_1015554972 5 Left 1015554960 6:134451734-134451756 CCTGCAGGCCCAGGCCCCTGCCT No data
Right 1015554972 6:134451762-134451784 AATGGCTGTAGTCACTGGAAGGG No data
1015554960_1015554971 4 Left 1015554960 6:134451734-134451756 CCTGCAGGCCCAGGCCCCTGCCT No data
Right 1015554971 6:134451761-134451783 AAATGGCTGTAGTCACTGGAAGG No data
1015554960_1015554981 30 Left 1015554960 6:134451734-134451756 CCTGCAGGCCCAGGCCCCTGCCT No data
Right 1015554981 6:134451787-134451809 TTGGGGAGCAGAGAGTGGAGGGG No data
1015554960_1015554973 6 Left 1015554960 6:134451734-134451756 CCTGCAGGCCCAGGCCCCTGCCT No data
Right 1015554973 6:134451763-134451785 ATGGCTGTAGTCACTGGAAGGGG No data
1015554960_1015554976 12 Left 1015554960 6:134451734-134451756 CCTGCAGGCCCAGGCCCCTGCCT No data
Right 1015554976 6:134451769-134451791 GTAGTCACTGGAAGGGGGTTGGG No data
1015554960_1015554975 11 Left 1015554960 6:134451734-134451756 CCTGCAGGCCCAGGCCCCTGCCT No data
Right 1015554975 6:134451768-134451790 TGTAGTCACTGGAAGGGGGTTGG No data
1015554960_1015554977 13 Left 1015554960 6:134451734-134451756 CCTGCAGGCCCAGGCCCCTGCCT No data
Right 1015554977 6:134451770-134451792 TAGTCACTGGAAGGGGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015554960 Original CRISPR AGGCAGGGGCCTGGGCCTGC AGG (reversed) Intergenic
No off target data available for this crispr