ID: 1015565655

View in Genome Browser
Species Human (GRCh38)
Location 6:134567810-134567832
Sequence CAGAGAGGGGAGAGCTTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015565655_1015565661 13 Left 1015565655 6:134567810-134567832 CCAGTCAAGCTCTCCCCTCTCTG No data
Right 1015565661 6:134567846-134567868 CTCTTAAACTGCCTCTGTGACGG No data
1015565655_1015565662 14 Left 1015565655 6:134567810-134567832 CCAGTCAAGCTCTCCCCTCTCTG No data
Right 1015565662 6:134567847-134567869 TCTTAAACTGCCTCTGTGACGGG No data
1015565655_1015565663 15 Left 1015565655 6:134567810-134567832 CCAGTCAAGCTCTCCCCTCTCTG No data
Right 1015565663 6:134567848-134567870 CTTAAACTGCCTCTGTGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015565655 Original CRISPR CAGAGAGGGGAGAGCTTGAC TGG (reversed) Intergenic