ID: 1015565662

View in Genome Browser
Species Human (GRCh38)
Location 6:134567847-134567869
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015565656_1015565662 1 Left 1015565656 6:134567823-134567845 CCCCTCTCTGAGACTCTGCCCTG No data
Right 1015565662 6:134567847-134567869 TCTTAAACTGCCTCTGTGACGGG No data
1015565658_1015565662 -1 Left 1015565658 6:134567825-134567847 CCTCTCTGAGACTCTGCCCTGCT No data
Right 1015565662 6:134567847-134567869 TCTTAAACTGCCTCTGTGACGGG No data
1015565657_1015565662 0 Left 1015565657 6:134567824-134567846 CCCTCTCTGAGACTCTGCCCTGC No data
Right 1015565662 6:134567847-134567869 TCTTAAACTGCCTCTGTGACGGG No data
1015565655_1015565662 14 Left 1015565655 6:134567810-134567832 CCAGTCAAGCTCTCCCCTCTCTG No data
Right 1015565662 6:134567847-134567869 TCTTAAACTGCCTCTGTGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015565662 Original CRISPR TCTTAAACTGCCTCTGTGAC GGG Intergenic