ID: 1015567947

View in Genome Browser
Species Human (GRCh38)
Location 6:134593221-134593243
Sequence CCTCCCGGGACCCTGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015567947_1015567956 14 Left 1015567947 6:134593221-134593243 CCTCCTGCCAGGGTCCCGGGAGG No data
Right 1015567956 6:134593258-134593280 GAGGCTGCTCAGCAGTTTTTGGG No data
1015567947_1015567955 13 Left 1015567947 6:134593221-134593243 CCTCCTGCCAGGGTCCCGGGAGG No data
Right 1015567955 6:134593257-134593279 TGAGGCTGCTCAGCAGTTTTTGG No data
1015567947_1015567954 -5 Left 1015567947 6:134593221-134593243 CCTCCTGCCAGGGTCCCGGGAGG No data
Right 1015567954 6:134593239-134593261 GGAGGAGGTGTGCAGCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015567947 Original CRISPR CCTCCCGGGACCCTGGCAGG AGG (reversed) Intergenic