ID: 1015571590

View in Genome Browser
Species Human (GRCh38)
Location 6:134626663-134626685
Sequence CTTGAATGCCAGAGAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015571590_1015571594 12 Left 1015571590 6:134626663-134626685 CCTGGCTCTCTCTGGCATTCAAG No data
Right 1015571594 6:134626698-134626720 ATGCTAGCACCAAACTACCAGGG No data
1015571590_1015571593 11 Left 1015571590 6:134626663-134626685 CCTGGCTCTCTCTGGCATTCAAG No data
Right 1015571593 6:134626697-134626719 GATGCTAGCACCAAACTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015571590 Original CRISPR CTTGAATGCCAGAGAGAGCC AGG (reversed) Intergenic
No off target data available for this crispr