ID: 1015573593

View in Genome Browser
Species Human (GRCh38)
Location 6:134647460-134647482
Sequence AGGAAGAACAGAATGGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015573586_1015573593 17 Left 1015573586 6:134647420-134647442 CCATGCACTAAAACCAGGATTCA No data
Right 1015573593 6:134647460-134647482 AGGAAGAACAGAATGGATGGTGG No data
1015573588_1015573593 4 Left 1015573588 6:134647433-134647455 CCAGGATTCAGTTAGAAGATGGA No data
Right 1015573593 6:134647460-134647482 AGGAAGAACAGAATGGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015573593 Original CRISPR AGGAAGAACAGAATGGATGG TGG Intergenic
No off target data available for this crispr