ID: 1015578934

View in Genome Browser
Species Human (GRCh38)
Location 6:134702470-134702492
Sequence AGAGAGAGTGCAGTGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015578934_1015578941 26 Left 1015578934 6:134702470-134702492 CCCACAGTCACTGCACTCTCTCT No data
Right 1015578941 6:134702519-134702541 CACACAGCCCAGCTGCTGCTGGG No data
1015578934_1015578940 25 Left 1015578934 6:134702470-134702492 CCCACAGTCACTGCACTCTCTCT No data
Right 1015578940 6:134702518-134702540 CCACACAGCCCAGCTGCTGCTGG No data
1015578934_1015578942 27 Left 1015578934 6:134702470-134702492 CCCACAGTCACTGCACTCTCTCT No data
Right 1015578942 6:134702520-134702542 ACACAGCCCAGCTGCTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015578934 Original CRISPR AGAGAGAGTGCAGTGACTGT GGG (reversed) Intergenic
No off target data available for this crispr