ID: 1015578940

View in Genome Browser
Species Human (GRCh38)
Location 6:134702518-134702540
Sequence CCACACAGCCCAGCTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015578934_1015578940 25 Left 1015578934 6:134702470-134702492 CCCACAGTCACTGCACTCTCTCT No data
Right 1015578940 6:134702518-134702540 CCACACAGCCCAGCTGCTGCTGG No data
1015578935_1015578940 24 Left 1015578935 6:134702471-134702493 CCACAGTCACTGCACTCTCTCTC No data
Right 1015578940 6:134702518-134702540 CCACACAGCCCAGCTGCTGCTGG No data
1015578937_1015578940 1 Left 1015578937 6:134702494-134702516 CCGCAAGAGCTCAGATTCTCTCC No data
Right 1015578940 6:134702518-134702540 CCACACAGCCCAGCTGCTGCTGG No data
1015578936_1015578940 2 Left 1015578936 6:134702493-134702515 CCCGCAAGAGCTCAGATTCTCTC No data
Right 1015578940 6:134702518-134702540 CCACACAGCCCAGCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015578940 Original CRISPR CCACACAGCCCAGCTGCTGC TGG Intergenic
No off target data available for this crispr