ID: 1015589124

View in Genome Browser
Species Human (GRCh38)
Location 6:134805463-134805485
Sequence GCGTGTAAAGGGCTGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015589124_1015589134 17 Left 1015589124 6:134805463-134805485 CCCTCCTCCAGCCCTTTACACGC No data
Right 1015589134 6:134805503-134805525 TGACCGAAAAACAGAACACTGGG No data
1015589124_1015589133 16 Left 1015589124 6:134805463-134805485 CCCTCCTCCAGCCCTTTACACGC No data
Right 1015589133 6:134805502-134805524 TTGACCGAAAAACAGAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015589124 Original CRISPR GCGTGTAAAGGGCTGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr