ID: 1015590984

View in Genome Browser
Species Human (GRCh38)
Location 6:134822988-134823010
Sequence CAGATTTGGAACTAGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015590979_1015590984 0 Left 1015590979 6:134822965-134822987 CCAGGCCTCATTCCAGGGAGGGG No data
Right 1015590984 6:134822988-134823010 CAGATTTGGAACTAGAGCCCAGG No data
1015590976_1015590984 4 Left 1015590976 6:134822961-134822983 CCTTCCAGGCCTCATTCCAGGGA No data
Right 1015590984 6:134822988-134823010 CAGATTTGGAACTAGAGCCCAGG No data
1015590981_1015590984 -5 Left 1015590981 6:134822970-134822992 CCTCATTCCAGGGAGGGGCAGAT No data
Right 1015590984 6:134822988-134823010 CAGATTTGGAACTAGAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015590984 Original CRISPR CAGATTTGGAACTAGAGCCC AGG Intergenic
No off target data available for this crispr