ID: 1015592368

View in Genome Browser
Species Human (GRCh38)
Location 6:134834073-134834095
Sequence GTGGGTTAGGGGAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015592356_1015592368 2 Left 1015592356 6:134834048-134834070 CCACAGAGAGAAAGGGGGAGGGA No data
Right 1015592368 6:134834073-134834095 GTGGGTTAGGGGAGGGAGGGAGG No data
1015592348_1015592368 13 Left 1015592348 6:134834037-134834059 CCTCCTCAAGTCCACAGAGAGAA No data
Right 1015592368 6:134834073-134834095 GTGGGTTAGGGGAGGGAGGGAGG No data
1015592349_1015592368 10 Left 1015592349 6:134834040-134834062 CCTCAAGTCCACAGAGAGAAAGG No data
Right 1015592368 6:134834073-134834095 GTGGGTTAGGGGAGGGAGGGAGG No data
1015592347_1015592368 14 Left 1015592347 6:134834036-134834058 CCCTCCTCAAGTCCACAGAGAGA No data
Right 1015592368 6:134834073-134834095 GTGGGTTAGGGGAGGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015592368 Original CRISPR GTGGGTTAGGGGAGGGAGGG AGG Intergenic
No off target data available for this crispr