ID: 1015594328

View in Genome Browser
Species Human (GRCh38)
Location 6:134851737-134851759
Sequence GTGAGTTAACAGAAGGCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015594323_1015594328 3 Left 1015594323 6:134851711-134851733 CCAGAAGTAGGGTAACATGACCA No data
Right 1015594328 6:134851737-134851759 GTGAGTTAACAGAAGGCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015594328 Original CRISPR GTGAGTTAACAGAAGGCAGG CGG Intergenic
No off target data available for this crispr