ID: 1015595626

View in Genome Browser
Species Human (GRCh38)
Location 6:134863837-134863859
Sequence CTGTCTATATTGCTGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015595626_1015595631 12 Left 1015595626 6:134863837-134863859 CCACCCACCAGCAATATAGACAG No data
Right 1015595631 6:134863872-134863894 AACACCATGAACTTTCCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015595626 Original CRISPR CTGTCTATATTGCTGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr