ID: 1015595631

View in Genome Browser
Species Human (GRCh38)
Location 6:134863872-134863894
Sequence AACACCATGAACTTTCCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015595625_1015595631 13 Left 1015595625 6:134863836-134863858 CCCACCCACCAGCAATATAGACA No data
Right 1015595631 6:134863872-134863894 AACACCATGAACTTTCCACAAGG No data
1015595626_1015595631 12 Left 1015595626 6:134863837-134863859 CCACCCACCAGCAATATAGACAG No data
Right 1015595631 6:134863872-134863894 AACACCATGAACTTTCCACAAGG No data
1015595624_1015595631 19 Left 1015595624 6:134863830-134863852 CCACTTCCCACCCACCAGCAATA No data
Right 1015595631 6:134863872-134863894 AACACCATGAACTTTCCACAAGG No data
1015595629_1015595631 5 Left 1015595629 6:134863844-134863866 CCAGCAATATAGACAGCAACAGT No data
Right 1015595631 6:134863872-134863894 AACACCATGAACTTTCCACAAGG No data
1015595628_1015595631 8 Left 1015595628 6:134863841-134863863 CCACCAGCAATATAGACAGCAAC No data
Right 1015595631 6:134863872-134863894 AACACCATGAACTTTCCACAAGG No data
1015595627_1015595631 9 Left 1015595627 6:134863840-134863862 CCCACCAGCAATATAGACAGCAA No data
Right 1015595631 6:134863872-134863894 AACACCATGAACTTTCCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015595631 Original CRISPR AACACCATGAACTTTCCACA AGG Intergenic
No off target data available for this crispr