ID: 1015598161

View in Genome Browser
Species Human (GRCh38)
Location 6:134886278-134886300
Sequence CAGGTACAAGATCTAGTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015598161_1015598164 -4 Left 1015598161 6:134886278-134886300 CCTAGCACTAGATCTTGTACCTG No data
Right 1015598164 6:134886297-134886319 CCTGGAAAGTATTTAATATTTGG No data
1015598161_1015598165 -1 Left 1015598161 6:134886278-134886300 CCTAGCACTAGATCTTGTACCTG No data
Right 1015598165 6:134886300-134886322 GGAAAGTATTTAATATTTGGTGG No data
1015598161_1015598166 15 Left 1015598161 6:134886278-134886300 CCTAGCACTAGATCTTGTACCTG No data
Right 1015598166 6:134886316-134886338 TTGGTGGATAAATAAATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015598161 Original CRISPR CAGGTACAAGATCTAGTGCT AGG (reversed) Intergenic
No off target data available for this crispr