ID: 1015598166

View in Genome Browser
Species Human (GRCh38)
Location 6:134886316-134886338
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015598160_1015598166 20 Left 1015598160 6:134886273-134886295 CCAGACCTAGCACTAGATCTTGT No data
Right 1015598166 6:134886316-134886338 TTGGTGGATAAATAAATCAAAGG No data
1015598161_1015598166 15 Left 1015598161 6:134886278-134886300 CCTAGCACTAGATCTTGTACCTG No data
Right 1015598166 6:134886316-134886338 TTGGTGGATAAATAAATCAAAGG No data
1015598163_1015598166 -4 Left 1015598163 6:134886297-134886319 CCTGGAAAGTATTTAATATTTGG No data
Right 1015598166 6:134886316-134886338 TTGGTGGATAAATAAATCAAAGG No data
1015598159_1015598166 21 Left 1015598159 6:134886272-134886294 CCCAGACCTAGCACTAGATCTTG No data
Right 1015598166 6:134886316-134886338 TTGGTGGATAAATAAATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015598166 Original CRISPR TTGGTGGATAAATAAATCAA AGG Intergenic
No off target data available for this crispr