ID: 1015603524

View in Genome Browser
Species Human (GRCh38)
Location 6:134933392-134933414
Sequence CTGGACACCAAGATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 335}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015603524_1015603529 14 Left 1015603524 6:134933392-134933414 CCCTGCTCCATCTTGGTGTCCAG 0: 1
1: 0
2: 4
3: 29
4: 335
Right 1015603529 6:134933429-134933451 TGTGAAAACATTAAGTAGAGAGG 0: 1
1: 0
2: 3
3: 24
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015603524 Original CRISPR CTGGACACCAAGATGGAGCA GGG (reversed) Intronic
900112547 1:1014628-1014650 CTGGTCACCAGGATGGACCCTGG - Intergenic
900165253 1:1241918-1241940 CGGGGCACCCAGGTGGAGCAGGG - Intergenic
900243687 1:1628310-1628332 GTGGACGCCAAGAAGGAGGACGG + Exonic
900300128 1:1973018-1973040 CTGAACACCCAGAAGGAGCTCGG - Exonic
901400748 1:9013795-9013817 CGGGACACCAGGGTGGAGCCCGG + Intronic
903050052 1:20593968-20593990 CTGGACACCCAGAGGAAGCCTGG + Intronic
903274609 1:22212608-22212630 CTGGGCACCGGGATGGGGCAAGG + Intergenic
903874945 1:26467534-26467556 CTGGAGACAGACATGGAGCAGGG - Intronic
904101029 1:28027528-28027550 CTGGACACCAACATGCAAAAGGG + Intronic
904136177 1:28314272-28314294 CTGGACAGAAAGGTGGAGCCTGG + Intergenic
904208591 1:28871193-28871215 CTTGGTACCAAGATGGAGCCTGG - Intergenic
904347678 1:29883962-29883984 CTGGGCACCAAGCTGATGCAGGG - Intergenic
904899799 1:33847935-33847957 CTGGAAATCAAGATGAAGAATGG - Intronic
905530585 1:38675558-38675580 AGGGACACCAGGATGGTGCAGGG - Intergenic
906603868 1:47151411-47151433 CTGGCCACCCTGATGGGGCAGGG + Intergenic
907834212 1:58093753-58093775 AAGGACACCAATATGGGGCATGG + Intronic
908356863 1:63330426-63330448 CTGGACCCCGGGAAGGAGCATGG - Intergenic
909948148 1:81687461-81687483 ATGGACACCAAAAGTGAGCAGGG - Intronic
911678704 1:100689862-100689884 ATGGACACCAAAAGCGAGCAGGG - Intergenic
912572436 1:110634333-110634355 CTGGAGACCAAGGTGGGGCCAGG - Intergenic
913463944 1:119119242-119119264 ATGGACACCAAAAGTGAGCAGGG + Intronic
914346267 1:146801322-146801344 ATGGACACCAAAAGAGAGCAGGG + Intergenic
914455281 1:147830990-147831012 ATGGACACCAAAAGTGAGCAGGG - Intergenic
917319191 1:173761055-173761077 ATGGACACCAAAAGCGAGCAGGG + Intronic
917695641 1:177520454-177520476 CTGGAAACCAAGAGAGAACATGG + Intergenic
917898265 1:179514883-179514905 ATGGACACCAAAAGCGAGCAGGG - Intronic
920170599 1:204070087-204070109 CTGGAGACCAGGATGGAGGAGGG + Intergenic
920968348 1:210720824-210720846 CTGGACAACATAAAGGAGCAGGG - Intronic
921834717 1:219766054-219766076 ATGGACACCAAAAGTGAGCAGGG + Intronic
922658078 1:227403043-227403065 ATGGACACCAAAAGTGAGCAGGG + Intergenic
922927159 1:229359233-229359255 ATGGACACCAAAAGCGAGCAGGG - Intergenic
924861271 1:247925079-247925101 CTGGACACCATGAGGGAGGAAGG + Intergenic
1064803504 10:19103625-19103647 CTGGAGCTCAGGATGGAGCATGG + Intronic
1068480979 10:57587632-57587654 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1068793577 10:61053260-61053282 CTGGACATAAAGATGAAGAATGG + Intergenic
1069479073 10:68764200-68764222 ATTGAAACCCAGATGGAGCAAGG - Intronic
1073701103 10:105927578-105927600 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1073828072 10:107348844-107348866 CCATACACTAAGATGGAGCAGGG - Intergenic
1074520956 10:114223414-114223436 CTGGAGCCCAAGATTGAGGAAGG - Intronic
1074934590 10:118165577-118165599 CTTGCCATCAAGATAGAGCAGGG + Intergenic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1077265176 11:1645076-1645098 CTGGCCAGAGAGATGGAGCAGGG - Intergenic
1077797574 11:5508266-5508288 GTGGAGACCAAGATGGTGCAGGG - Exonic
1079345133 11:19645219-19645241 CTGGCCTCGAAGATGGAGGAAGG - Intronic
1079456753 11:20642985-20643007 CTGGACCCCAAGCTGTAGGAAGG - Intronic
1079614948 11:22480721-22480743 CTGTACCCCAATATGGAGCAAGG - Intergenic
1082958462 11:58896622-58896644 AAGGACACAAAGATGGAGTAGGG + Intronic
1083367551 11:62150604-62150626 CAGAACACCAAGCTGGAGCCTGG + Intronic
1084558281 11:69888127-69888149 CTGGACAGCAAGAAGGAGCAAGG - Intergenic
1085969438 11:81569080-81569102 GTGAACAACAAGGTGGAGCAGGG - Intergenic
1086153407 11:83638874-83638896 ATGGACACTTGGATGGAGCAAGG + Intronic
1087204026 11:95375133-95375155 CAGAACTCCAAGATGGAGGAGGG + Intergenic
1087306949 11:96499779-96499801 CTGGCCACCAGTATGGGGCAAGG + Intronic
1088049364 11:105492633-105492655 CTGGGCACCAAAAGGGAACAGGG + Intergenic
1088137507 11:106576111-106576133 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1088686477 11:112288457-112288479 CTGGAGGCCAAGAAGGAGCTGGG + Intergenic
1089082637 11:115789708-115789730 CTGGACCCCAGGATGGGGAAGGG + Intergenic
1091210268 11:133852271-133852293 ATGGACACCAAAAGCGAGCAGGG - Intergenic
1091712760 12:2753319-2753341 CTGGACACCAAGAGACAGGAAGG - Intergenic
1092194880 12:6543163-6543185 AGGGTCACTAAGATGGAGCAAGG - Intronic
1092273503 12:7041517-7041539 CAGGACACCGACATGGAACAGGG - Intronic
1093488506 12:19679457-19679479 ATGGACACCAAAAGTGAGCAGGG - Intronic
1095732949 12:45524777-45524799 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1096004906 12:48161637-48161659 CTGGACACCCAGATTCAGGAGGG + Intronic
1096054628 12:48641149-48641171 CTGGACACAAAGCTGAAGCATGG - Intergenic
1096077093 12:48812716-48812738 CTGCAGAGCAAGATGGAGAAGGG + Intergenic
1096348090 12:50868317-50868339 ATGGACACCAAAAGAGAGCAGGG + Intronic
1096437866 12:51610204-51610226 CCGGACACCAAGAGTGAGCAGGG - Intronic
1097385757 12:58948562-58948584 ATGGACACCAAAAATGAGCAGGG - Intergenic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1099777226 12:87149461-87149483 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1100290795 12:93213067-93213089 ATGGACACCAAAAGCGAGCAGGG - Intergenic
1101635066 12:106533598-106533620 ATGGACACCAAAAGTGAGCAGGG - Intronic
1102096467 12:110245435-110245457 CTGGACAGCAACCTGGAGTAGGG + Intergenic
1103401238 12:120644420-120644442 CTGGCCACAAAGAGGGAGTACGG - Intronic
1103907089 12:124333272-124333294 CTGGAGACCTGGATGGAGAAAGG + Exonic
1104062480 12:125280501-125280523 ATGGACACTCAGATTGAGCAAGG - Intronic
1104343795 12:127977460-127977482 CAGGACACTAAGAAGAAGCAAGG + Intergenic
1104470788 12:129028138-129028160 CTGGGCACCAACTTGGTGCAAGG - Intergenic
1104618202 12:130288529-130288551 CTGGACAGCAGGAGGGAGAATGG - Intergenic
1105599337 13:21872009-21872031 CTGGTCCCCAAGCTGGAACAAGG - Intergenic
1105616143 13:22014642-22014664 CCGGGCACCAAGGAGGAGCATGG - Intergenic
1105908483 13:24837046-24837068 ATGGACACCAAAAACGAGCAAGG + Intronic
1106238606 13:27888086-27888108 CTGGACTCCAAAATGGGGTAGGG + Intergenic
1107432194 13:40350183-40350205 CTGGAGAACAGCATGGAGCAAGG - Intergenic
1108338521 13:49472360-49472382 CTGAACATCAAAGTGGAGCATGG - Intronic
1108831847 13:54488899-54488921 ATGGACACCAAAATTAAGCAGGG + Intergenic
1110411943 13:75214346-75214368 CTGGACATCAAGCTGGAACTTGG + Intergenic
1112035194 13:95491075-95491097 ATGGACACCAAAAGCGAGCAGGG - Intronic
1112486988 13:99828852-99828874 TTGGACACCGTGATGGAGCCTGG - Intronic
1112747514 13:102543396-102543418 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1113268767 13:108649144-108649166 CAGCACACCAATATGGCGCATGG + Intronic
1113269744 13:108660594-108660616 ATGGACACCAAAAGGAAGCAGGG - Intronic
1113738222 13:112692965-112692987 GTGAACACCAAGAAGGAACAGGG - Intronic
1113811894 13:113147714-113147736 CTGGACACCCAGTGGGAGAAGGG - Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114889243 14:26896082-26896104 CTGGATATCCAGCTGGAGCAAGG + Intergenic
1115695043 14:35887845-35887867 CTGGACACCTAGAATAAGCAGGG - Intronic
1116379004 14:44240847-44240869 CAGCACACCAACATGGTGCATGG + Intergenic
1116596543 14:46855531-46855553 CTGGTTTCCAAGATGGAGGAAGG + Intronic
1116732195 14:48638002-48638024 ATGGACACCAAAAGTGAGCAAGG + Intergenic
1116897344 14:50329877-50329899 CTGGACACCATCATCAAGCATGG + Exonic
1117112969 14:52477494-52477516 ATGGACACCAAAAGCGAGCAGGG + Intronic
1117384558 14:55198052-55198074 CAAGACACCAAGATGTAGCTAGG - Intergenic
1119098672 14:71858271-71858293 ATGGACACCAAAAGCGAGCAGGG + Intergenic
1121545170 14:94757906-94757928 CTGGAGAGCAACATGGAGCATGG + Intergenic
1121613667 14:95298408-95298430 CTGGAGACCAAACTGGTGCAAGG + Intronic
1121839015 14:97117430-97117452 GAGGACACCAAGAAGGAGCAGGG - Intergenic
1121945069 14:98112383-98112405 CTAGACACCAATATGGTGCATGG - Intergenic
1124386793 15:29215718-29215740 ATTGACACCAAAAGGGAGCAGGG - Intronic
1127718832 15:61679738-61679760 CTGGAAACCAAGCTAGAACAGGG + Intergenic
1128238947 15:66086993-66087015 CTGGACACCAAAAGCGAGCAGGG + Intronic
1128415221 15:67438728-67438750 CCGGACACCAAAAGCGAGCAGGG + Intronic
1129097389 15:73223602-73223624 ATGGACACCAAAAGCGAGCAGGG - Intronic
1129304718 15:74651252-74651274 CTGGACACCATTATTTAGCAGGG + Intronic
1130052993 15:80499257-80499279 TTGCACACCAAGATGCAGCGGGG - Intronic
1130419359 15:83728177-83728199 ATGGAAACCAAGAAAGAGCAGGG - Intronic
1131675649 15:94667589-94667611 CTTGGCACCAAGTTGGAGCATGG - Intergenic
1132114505 15:99125664-99125686 CTGGGCACAAAAACGGAGCAGGG - Intronic
1132982598 16:2746146-2746168 GCGGTCACCAAGCTGGAGCAGGG + Intergenic
1135911719 16:26567357-26567379 CTGGATACGAAGCCGGAGCAGGG + Intergenic
1136999223 16:35214908-35214930 CTGGCCAACCAGATGCAGCAAGG - Intergenic
1137497226 16:48979891-48979913 CTGAAGAACAAGATTGAGCAGGG + Intergenic
1139480616 16:67228600-67228622 ATGGACCTCAACATGGAGCAGGG + Exonic
1139987713 16:70913946-70913968 ATGGACACCAAAAGAGAGCAGGG - Intronic
1141555994 16:84837054-84837076 CTGGACTCCGAGATGGAGACTGG - Intronic
1143880551 17:10026514-10026536 CTGGACACCCAGAAGCAGCCAGG + Intronic
1144136700 17:12302117-12302139 CTGGAGACCGAGAAGGAGAATGG - Intergenic
1144823025 17:18088641-18088663 CTGTGTACTAAGATGGAGCAGGG - Intronic
1145289092 17:21529076-21529098 CGGGAAACCAAGATGGATCAGGG + Exonic
1146751242 17:35383053-35383075 ATGGACACCAAAAGCGAGCAGGG - Intergenic
1147479466 17:40745446-40745468 CTGGGGACCAAGTTGGTGCAAGG + Intergenic
1147654405 17:42080615-42080637 CTGGCCAGCAAGGTGGACCATGG - Intergenic
1147901064 17:43785150-43785172 CTGGAGACCCTGGTGGAGCAGGG + Exonic
1148408045 17:47437579-47437601 ATGGACACCAAAAGTGAGCAGGG - Intronic
1151060246 17:71084126-71084148 CTAGATACCAAGGTGGAGAAGGG - Intergenic
1151335246 17:73435747-73435769 CTAGACACCAAGATTCACCAGGG - Intronic
1151656786 17:75499865-75499887 CTGAACCTGAAGATGGAGCAGGG + Exonic
1152226679 17:79096022-79096044 CTGGACACCAGGAAGGGTCAAGG + Intronic
1152635575 17:81429316-81429338 GGGGACAGCAAGCTGGAGCACGG - Intronic
1153168718 18:2291511-2291533 ATGGACACCAAAAGTGAGCAAGG - Intergenic
1153400674 18:4680940-4680962 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1156490189 18:37491553-37491575 CTGGAGACCAAGAGGGACTATGG + Intronic
1156792869 18:40998806-40998828 ATGGACACCAAAAGAGAGCAGGG + Intergenic
1158756713 18:60333756-60333778 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1160267414 18:77352066-77352088 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1160664724 19:320182-320204 CTGGGCAACAAGATGAAGCCTGG + Intronic
1161615594 19:5268522-5268544 CAGGAGGCCAAGATGGGGCAAGG + Intronic
1162548529 19:11345609-11345631 CAGGACTGCAAGATGGAGGAAGG - Exonic
1164639382 19:29812702-29812724 CGGGACACCATGAAGGAGGACGG + Exonic
1165017049 19:32889096-32889118 CTGGAGACCAGGATGGGGTAGGG + Intronic
1165116718 19:33533258-33533280 CTGGAAACCAGGAAGGAGGAGGG - Intergenic
1166569317 19:43783763-43783785 AGGGACACGAAGATGGAGAAAGG - Intergenic
1166604046 19:44124834-44124856 ATGGACACCAAAAATGAGCAGGG - Intronic
1167639753 19:50674335-50674357 CTGGTCTCAAAGATGGAGAAGGG - Intronic
1167743831 19:51339857-51339879 CGGGTCACCAAGAAGGAGCTGGG - Intronic
1168395877 19:56048041-56048063 ATGGACACCAAAAGCGAGCAGGG - Intronic
1168458213 19:56531932-56531954 ATGGACACCAAAAAGAAGCAGGG - Intergenic
1168592974 19:57652128-57652150 CTGGCCACCAATATGGGGCAGGG + Intergenic
924973042 2:148431-148453 ATGGAAACCAAAAAGGAGCAAGG - Intergenic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
927328147 2:21830638-21830660 ATGGACACCAAAAGAGAGCAGGG - Intergenic
928450033 2:31370505-31370527 CAGGTCAGCAAGCTGGAGCAGGG + Intronic
928733913 2:34263324-34263346 ATGGACACCAAAAGTGAGCAGGG + Intergenic
929115002 2:38436570-38436592 CTAGACACCAAAATGGAGCAAGG - Intergenic
931430516 2:62205561-62205583 CAGGAATCCGAGATGGAGCAGGG + Intronic
931524963 2:63143239-63143261 ATGGACACCAAAAGCGAGCAGGG - Intronic
932100357 2:68894087-68894109 ATAGACACCAAAAGGGAGCAGGG - Intergenic
932252885 2:70259470-70259492 CTGGCTACCATGATGGTGCAGGG + Exonic
932270507 2:70404895-70404917 ATGGACACCAAAAGTGAGCAGGG + Intergenic
935597326 2:104889429-104889451 ATGCACACCAGGGTGGAGCATGG - Intergenic
935954172 2:108358719-108358741 ATGGACACCAAAAGTGAGCAGGG + Intergenic
937058071 2:118956313-118956335 ATGGACACCAAAAGTGAGCAGGG + Intronic
937781776 2:125846981-125847003 ATGGACACCAAAAGTGAGCAGGG - Intergenic
937990491 2:127659449-127659471 CAGGCCACCAAGGTGGAGCCTGG + Intronic
938037835 2:128051010-128051032 ATGGACACCAAAAGAGAGCAGGG - Intergenic
939144803 2:138400164-138400186 CTAGACACCAAGATTGAACCAGG + Intergenic
940172162 2:150841171-150841193 ATGGACACCAAAAGTGAGCAGGG - Intergenic
942726286 2:179011292-179011314 ATGGACACCAAAAATGAGCAGGG + Intronic
943441866 2:187935279-187935301 CTGGAAACTAAGCCGGAGCAAGG - Intergenic
943602845 2:189941986-189942008 CTGGAAACCAAAAAAGAGCAGGG + Intronic
943891088 2:193288361-193288383 ATGGACACCAAAAGTGAGCAGGG - Intergenic
944283047 2:197920338-197920360 CTGGACACTACCATGTAGCATGG + Intronic
945825952 2:214719929-214719951 ATGGACACCAAAAGCGAGCAGGG + Intergenic
946239400 2:218344711-218344733 CTGAACTCCAGGATGGGGCAGGG + Intronic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
948445291 2:238027891-238027913 CGGGACAACAAGGTGGAGCCAGG - Intronic
948642667 2:239385450-239385472 CTGGCCACCAACAGGGAGCCGGG - Intronic
948712614 2:239834335-239834357 CTGGCCACCAGGATGGCTCACGG - Intergenic
1170245549 20:14218333-14218355 ATGGACACCAAAAGTGAGCAGGG - Intronic
1170580090 20:17692543-17692565 GTGGACACCAAGGAGGGGCATGG + Intergenic
1175764141 20:61581458-61581480 CTGGCCATGAAGATGGAGGAGGG - Intronic
1176056594 20:63152241-63152263 CTTGGGACCAAGATGGAGCCAGG + Intergenic
1176082659 20:63281827-63281849 CCTGACACCAGGATGGAGCATGG + Intronic
1178801881 21:35803239-35803261 ATGGACACCAAAAGCGAGCAGGG + Intronic
1178983508 21:37284225-37284247 GCAGACACCATGATGGAGCATGG + Intergenic
1180914386 22:19475002-19475024 ATGGACACCAAGAGTCAGCATGG - Intronic
1181088977 22:20459018-20459040 CTGAGCACCAACAGGGAGCATGG + Intronic
1181553361 22:23653534-23653556 CTGAACACCAAGACAGAGCCAGG + Intergenic
1181868701 22:25880649-25880671 CTGGACACCTTGATAGAGCTAGG + Intronic
1182053508 22:27331408-27331430 CTGGTCATCAAGATGGAGCAGGG + Intergenic
1183004696 22:34891355-34891377 CTGGCCACCAAAAGGGAGCACGG - Intergenic
1183345603 22:37305922-37305944 CTGGCCATCCAGATGGGGCAGGG + Intronic
1184414185 22:44342647-44342669 CTGGACACCAAGTTGAAACCTGG - Intergenic
1185050893 22:48553466-48553488 CTGGACACCCAGGAGGAGGATGG + Intronic
949945341 3:9185345-9185367 CTGAGCACCAAGACGGGGCAGGG + Intronic
950831275 3:15878437-15878459 CTGGAGGCCAAGATGCGGCATGG + Intergenic
951572282 3:24077229-24077251 ATGGACACCAAAAGTGAGCAGGG - Intergenic
951852112 3:27152833-27152855 ATGGACACCAAAAGTGAGCAAGG + Intronic
952642703 3:35616792-35616814 CTGGAAAACATGTTGGAGCATGG - Intergenic
953171630 3:40512425-40512447 CTGGTCTCCCAGCTGGAGCAAGG + Exonic
953850621 3:46463459-46463481 CTGGACACCCACGGGGAGCAGGG + Intronic
955322732 3:57985874-57985896 GTGGAGACCAGGATGGAGCAGGG + Intergenic
955859899 3:63317553-63317575 ATGGACACCAAAAGTGAGCAGGG - Intronic
957429586 3:80084885-80084907 GTGGACACAAACATGGGGCAGGG - Intergenic
958969725 3:100598805-100598827 ATGGACACCAAAAGTGAGCAGGG - Intergenic
959605902 3:108241792-108241814 CAGGACACCAAGCTGGAGGTCGG - Intergenic
959899264 3:111641318-111641340 ATGGACACCAAAAGCGAGCAGGG + Intronic
962375928 3:134858725-134858747 GAGGACACTAAGGTGGAGCAGGG + Intronic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
962536436 3:136333439-136333461 CTGGACACCGAGATGGTAGAGGG + Intronic
963179754 3:142341742-142341764 ATGGAAACCAAAATGGAGCAGGG + Intronic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
964601042 3:158501670-158501692 ATGGACACCAACAGTGAGCAGGG - Intronic
965863004 3:173169780-173169802 TTGGAGACCAAGAAAGAGCATGG + Intergenic
968028949 3:195466423-195466445 CTGGCTTCGAAGATGGAGCAAGG - Intergenic
968125447 3:196156222-196156244 ATGGACACCAAAAGTGAGCAGGG - Intergenic
972653871 4:41047596-41047618 AAGGACACCAAGCTGTAGCAAGG + Intronic
973782648 4:54302976-54302998 ATGGACACCAAAATCGAGCAGGG + Intergenic
975898488 4:79122266-79122288 CTGGGCGCCAGGGTGGAGCAGGG - Intergenic
976556399 4:86455476-86455498 ATGGACACCAAAAGTGAGCAGGG + Intronic
976686128 4:87817550-87817572 ATGGACACCAAAAGTGAGCAGGG - Intergenic
978726477 4:111975744-111975766 ATGGACACCAAAAGCGAGCAGGG - Intergenic
979881372 4:125963785-125963807 CTGGACACCACCAAGGATCATGG - Intergenic
979995610 4:127427139-127427161 ATGGACACCAAAAGTGAGCAGGG + Intergenic
980087007 4:128401919-128401941 ATGGACACCAAAAGTGAGCAGGG - Intergenic
980309061 4:131102348-131102370 CTGGACACCATGATGGTGACAGG - Intergenic
980523808 4:133963161-133963183 ATGGACACCAAAATTGAGCAGGG + Intergenic
981461575 4:145018768-145018790 ATGGACACCAAAAGTGAGCAGGG + Intronic
982608606 4:157545076-157545098 CTGGAAACCAAAAAAGAGCAGGG - Intergenic
983010234 4:162537767-162537789 CTGGCCACCAGTATGGGGCAAGG - Intergenic
983732042 4:171007883-171007905 CTGGAGACCATGTTGGAGCTTGG + Intergenic
984721930 4:182980570-182980592 ATGGACACCAAAAGTGAGCAGGG + Intergenic
985668770 5:1195797-1195819 CTGGGCTCCAAGGTGGGGCAGGG - Intergenic
986487290 5:8250457-8250479 CTGTATAGCAACATGGAGCATGG + Intergenic
992183517 5:74221771-74221793 CAGCACACCAACATGGCGCATGG - Intergenic
995955533 5:117771792-117771814 ATGGACACCAAAAGTGAGCAGGG + Intergenic
996678538 5:126204159-126204181 ATGGACACCAAAAGTGAGCAGGG + Intergenic
996688716 5:126313938-126313960 CTGGATTCCAAGAGGGAGGAGGG + Intergenic
996984288 5:129539871-129539893 CTGGAAACAAATATGGAGAAAGG - Intronic
997601419 5:135141228-135141250 CTGGAGACCAAGGTGGAGCCAGG - Intronic
997761133 5:136448404-136448426 ATGGACACCAAAAGTGAGCAGGG + Intergenic
998423056 5:142005059-142005081 CTGGACACCAGACTGGAGCCTGG + Exonic
999484491 5:151981988-151982010 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1000823272 5:166011955-166011977 CTAGAAACCAAAATAGAGCAGGG - Intergenic
1000905272 5:166958804-166958826 AAGGACACCAAGATGGTGCATGG + Intergenic
1002423410 5:179162293-179162315 CTGGCCACCATGAAGGATCAGGG + Intronic
1002814071 6:661974-661996 ATGGACACCAAAAGAGAGCAGGG + Intronic
1003063357 6:2879596-2879618 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1003451089 6:6232272-6232294 ATGGACACCAAAAGCGAGCAGGG + Intronic
1003582222 6:7350079-7350101 ATGGACACCAAAAGCGAGCAGGG + Intronic
1004732131 6:18368224-18368246 CTGGAGGCCAAGATGCGGCATGG - Intergenic
1005062871 6:21793478-21793500 AAGGACACCAAGTTGTAGCATGG + Intergenic
1007825352 6:44595750-44595772 CTGGACTGCAAGATGGAGAAAGG + Intergenic
1007947219 6:45837393-45837415 CTGGGAAGCAAGAAGGAGCATGG + Intergenic
1008469794 6:51871531-51871553 GTGGCTACAAAGATGGAGCAAGG + Intronic
1008973374 6:57396471-57396493 ATGGACACCAAAAGTGAGCAGGG - Intronic
1009162277 6:60298015-60298037 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1009453379 6:63827094-63827116 ATGGACACCAAAAGCGAGCAGGG + Intronic
1009849538 6:69178252-69178274 CTGAACACAAAGAAGAAGCAGGG - Intronic
1011327356 6:86163785-86163807 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1011328875 6:86181996-86182018 ATGGACACCAAAATTGATCAGGG - Intergenic
1012738029 6:102975658-102975680 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1014531182 6:122561734-122561756 ATGGACACCAAAAGCGAGCAGGG - Intronic
1015565787 6:134569242-134569264 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1015603524 6:134933392-134933414 CTGGACACCAAGATGGAGCAGGG - Intronic
1016353772 6:143195614-143195636 CTGGCCACCCTGAGGGAGCACGG + Intronic
1017721007 6:157243084-157243106 CTGGACACCAACATCGAACAAGG + Intergenic
1017812618 6:157994920-157994942 CTGGAAAGCAAGGTGGTGCAGGG - Intronic
1018131368 6:160735037-160735059 AGGGACACCAAGAGGGAGGAAGG + Intronic
1019000353 6:168744330-168744352 CTGGACATCCACGTGGAGCAGGG + Intergenic
1019046013 6:169146782-169146804 GTGGACACCAAGAAGGGGGAGGG - Intergenic
1020853159 7:13382905-13382927 CTGTACAGCAAAATGGACCACGG - Intergenic
1022243815 7:28537875-28537897 CTGTACATCAAGATAGAGTAAGG - Intronic
1023748760 7:43349676-43349698 ATGGACACCAAAAGTGAGCAGGG - Intronic
1024791005 7:52964810-52964832 CTGGCCTCCAAGATGGAAGAAGG + Intergenic
1024917016 7:54513366-54513388 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1025107680 7:56185797-56185819 CTGCACCCCAAGATGGTGCTGGG + Intergenic
1026310568 7:69180291-69180313 CTGCACCCCAAGATGGTGCTGGG - Intergenic
1027745770 7:82071985-82072007 CTGGACAACATCATGGACCAGGG + Intronic
1028465943 7:91151804-91151826 ATGGTCACTAAGATGGAGAAAGG + Intronic
1028870405 7:95765361-95765383 CTGGAAACTAAGAGGGAGGAGGG + Intergenic
1028929237 7:96394705-96394727 ATGGAAACCAAAAGGGAGCAGGG - Intergenic
1029298591 7:99560662-99560684 CAGGACACCGACATGGAACAGGG + Exonic
1030498159 7:110326180-110326202 CTGCATATTAAGATGGAGCATGG + Intergenic
1030594969 7:111527039-111527061 CTGGTCCCCAAAAAGGAGCATGG + Intronic
1030886189 7:114940914-114940936 CTGGATAACAAGATGGAATAGGG - Intronic
1030936204 7:115587211-115587233 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1031011850 7:116532924-116532946 CTGGACACCAAGGAGGAAGAAGG + Intronic
1032019691 7:128400451-128400473 CTGGAGGCCAAGATGCGGCATGG - Exonic
1033097021 7:138441090-138441112 CTGGAGGCCAAGATGCAGCATGG + Intergenic
1033170963 7:139083860-139083882 CTGGCCATCATGAGGGAGCACGG - Exonic
1033670842 7:143491258-143491280 CTGGAGACTAAGCTGGAACAAGG + Intergenic
1034538965 7:151744048-151744070 ATGGGCTCGAAGATGGAGCACGG + Intronic
1034590283 7:152132532-152132554 CTGGGCACTGAGCTGGAGCACGG + Intergenic
1034755681 7:153617059-153617081 CTGGACACCAGCGTGGAGCCAGG + Intergenic
1038432509 8:27511510-27511532 CTGGACACCCAGCTGGAAGATGG + Intronic
1039641682 8:39229519-39229541 ATGGACACCAAAAGTGAGCAGGG + Intronic
1041293457 8:56331017-56331039 ATGGACACCAAAATCGAGCAGGG - Intergenic
1043510202 8:80943615-80943637 TTGGACATGAAGAGGGAGCAAGG - Intergenic
1043760281 8:84060076-84060098 ATGGAAACCAAAATGCAGCAGGG - Intergenic
1047032570 8:120898258-120898280 ATGGACACCAAAAGCGAGCAGGG + Intergenic
1047332357 8:123902627-123902649 ATGGACACCAAAAGCGAGCAGGG - Intronic
1048584396 8:135759376-135759398 CAGGACACCCAGATGTTGCAGGG + Intergenic
1048808590 8:138264034-138264056 CAGGAGATGAAGATGGAGCAGGG - Intronic
1051741747 9:20259084-20259106 CTGGCTTCCAAGATGGAGGAAGG + Intergenic
1052006464 9:23355765-23355787 ATGGACACCAAAAGGAAGCAGGG - Intergenic
1052941412 9:34134287-34134309 CTGGAGGCCAAGATGCGGCATGG - Intergenic
1053156173 9:35781258-35781280 CTGGAGAGGAAGATGGAGCCAGG + Intergenic
1054931422 9:70639454-70639476 CTGGATCCCAAGAAGGTGCAAGG + Intronic
1056101026 9:83301002-83301024 CTGGACACAAATATTAAGCAGGG + Intronic
1056322526 9:85450205-85450227 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1056548218 9:87630482-87630504 CAGGACTCCAAGAAGGACCAGGG - Intronic
1057528922 9:95826973-95826995 CTGGAAGGCAAGAGGGAGCAGGG - Intergenic
1058410665 9:104727198-104727220 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1058622995 9:106903743-106903765 ATGGACACCAAAAGTGAGCAGGG - Intronic
1058642704 9:107102798-107102820 CTGGACACCAGAATGGCGCGGGG - Intergenic
1058770870 9:108230184-108230206 ATGGACACCAAAAGCGAGCAGGG + Intergenic
1059525747 9:114989542-114989564 GAGGACCCCAAGAAGGAGCAGGG - Intergenic
1062276819 9:135735322-135735344 TTGGACCCCCAGAGGGAGCAGGG + Intronic
1203367888 Un_KI270442v1:274215-274237 ATGGAAACCAAAATGCAGCAGGG - Intergenic
1186782872 X:12930854-12930876 ATGGACACAAAGATGGGGGATGG - Intergenic
1187218994 X:17305926-17305948 ATGGACACCAAAAGCGAGCAGGG - Intergenic
1187492556 X:19765435-19765457 CTGGCCTCGAAGATGGAGGAAGG - Intronic
1187773399 X:22728650-22728672 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1189362047 X:40360314-40360336 CTGGAGGCCAAGATGCGGCATGG - Intergenic
1189413868 X:40796741-40796763 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1189659239 X:43279232-43279254 CTGGAGGCCAAGATGCGGCATGG - Intergenic
1190082429 X:47366819-47366841 CTGGACATCAAGACACAGCAGGG - Intergenic
1190263425 X:48813958-48813980 CTGGAGGCCCAAATGGAGCATGG - Intronic
1190449142 X:50560045-50560067 ATGGACACCAAAATCGAGCAGGG + Intergenic
1190631995 X:52397007-52397029 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1191906089 X:66092078-66092100 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1191994274 X:67074111-67074133 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1192337483 X:70234430-70234452 TAGGACATCAAGATGGAGAAAGG - Intergenic
1192820431 X:74638974-74638996 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1192913445 X:75630197-75630219 ATGGACACCAAAAGCGAGCAGGG - Intergenic
1193157097 X:78185484-78185506 ATGGACACCAAAATCAAGCAGGG + Intergenic
1193578719 X:83234695-83234717 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1193590894 X:83387542-83387564 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1194596563 X:95866318-95866340 ATGGAAACCAAGAGTGAGCAGGG + Intergenic
1195019307 X:100810831-100810853 ATGGACACCAAAAACGAGCAGGG - Intergenic
1195760077 X:108236431-108236453 GTGCACACCAAGATACAGCAAGG + Intronic
1195850319 X:109275740-109275762 CTGGACACCAAGGAGAAGCATGG + Intergenic
1195984967 X:110619859-110619881 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1196422263 X:115535058-115535080 CTGGCCAACATGATGGAACATGG - Intergenic
1196465042 X:115962949-115962971 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1196774865 X:119329028-119329050 GTGTACTCCAATATGGAGCAGGG + Intergenic
1197257075 X:124274957-124274979 CTTGACCCCAAGAGGCAGCAAGG + Intronic
1197668879 X:129254029-129254051 ATGGACACCAAAAGCGAGCAGGG - Intergenic
1197683557 X:129413358-129413380 CTAGACAACAAGATGGAAGAAGG + Intergenic
1198830124 X:140741545-140741567 TTGGACACCAAGATGAAGGAGGG + Intergenic
1199684971 X:150257643-150257665 CTGGAGAACAAGATGGAGAAGGG - Intergenic
1199821547 X:151454099-151454121 ATGGACACCAAAAGCGAGCAGGG + Intergenic
1199928985 X:152498829-152498851 CTGGACATCAAGATGGGGCAGGG + Intergenic
1200360874 X:155604668-155604690 CAGAGCACCAAGAGGGAGCATGG + Intronic
1201272100 Y:12265285-12265307 CTAGACCACAAGATGGACCAAGG + Intergenic