ID: 1015605943

View in Genome Browser
Species Human (GRCh38)
Location 6:134954756-134954778
Sequence CCTGTCAGGCCCCACGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015605943_1015605949 28 Left 1015605943 6:134954756-134954778 CCAAATGCGTGGGGCCTGACAGG No data
Right 1015605949 6:134954807-134954829 CTAGCCTACTTCCCTAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015605943 Original CRISPR CCTGTCAGGCCCCACGCATT TGG (reversed) Intergenic
No off target data available for this crispr