ID: 1015607963

View in Genome Browser
Species Human (GRCh38)
Location 6:134979956-134979978
Sequence TTACCTAGACATAGTCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015607962_1015607963 14 Left 1015607962 6:134979919-134979941 CCTAGGTGTTGCTATATATCTAG 0: 1
1: 0
2: 1
3: 8
4: 144
Right 1015607963 6:134979956-134979978 TTACCTAGACATAGTCCTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015607963 Original CRISPR TTACCTAGACATAGTCCTGA AGG Intronic
901615307 1:10534797-10534819 TTACCTAGACATTCCCCTAAAGG - Intronic
902811071 1:18888346-18888368 TTGCCGGGACATAGTGCTGACGG - Intronic
910698346 1:90045900-90045922 TTACCTAGACACAGTGATAAGGG - Intergenic
913111847 1:115664158-115664180 TTACCTGGCCATCGTCCTGCTGG + Exonic
913244204 1:116857299-116857321 TTACTTAGACATTGTCCTTTTGG + Intergenic
917494744 1:175530217-175530239 TTACTGAGACTTACTCCTGAGGG + Intronic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
918448925 1:184640770-184640792 TTCCCCAGCCAGAGTCCTGATGG - Intergenic
921553306 1:216566106-216566128 TTACCTAGAAACAGTGCTGCCGG - Intronic
1065993844 10:31037799-31037821 TTACTTAGACACAGTTCTGGAGG - Intergenic
1066210644 10:33234084-33234106 TTACCTAGAAAAAATGCTGATGG + Intronic
1068382548 10:56275652-56275674 TTACCTGGAGGTAGTTCTGATGG + Intergenic
1074642577 10:115404040-115404062 TTACCAAAACATATTCCTCAAGG - Intronic
1080004829 11:27395728-27395750 TTACGTAGATACATTCCTGAAGG - Intronic
1080339836 11:31249527-31249549 TTTCTTAGACATGGTCCTCAGGG - Intronic
1086087680 11:82971319-82971341 TGAGCTAGACACAGTGCTGATGG - Intergenic
1087939534 11:104078354-104078376 TTCCTTAGACATAGTGTTGATGG - Intronic
1089135434 11:116245391-116245413 TTACCAAGAGATAGCCCAGATGG - Intergenic
1089783368 11:120890430-120890452 TTTACTAAATATAGTCCTGAAGG - Intronic
1090905235 11:131068853-131068875 TGACCTAGACATGGTTGTGAAGG + Intergenic
1091405913 12:209490-209512 TGACCTTTACATAGTCATGAAGG + Intronic
1093528356 12:20131593-20131615 TTACATAAACTAAGTCCTGAGGG - Intergenic
1101065176 12:101013450-101013472 CAACCTACACATAGTCCTGTAGG + Intronic
1105773941 13:23639244-23639266 TTAGCTAGACATAGTGGTGTGGG + Intronic
1106530588 13:30587126-30587148 TTACAAAGAAATAGTCCTGAGGG - Intronic
1110549329 13:76794305-76794327 TTATATAAACATAGTCCTGGTGG - Intergenic
1111176529 13:84603610-84603632 TTACCTAGACCAAGGTCTGAAGG + Intergenic
1120111900 14:80567128-80567150 TTGCCTTGACAGAGACCTGAGGG + Intronic
1127702548 15:61515012-61515034 TTGCCTAAACATGGTGCTGAAGG - Intergenic
1130716804 15:86343032-86343054 TAACTTAGACATAGTCTTGGGGG + Intronic
1131652267 15:94413126-94413148 TTACTTAAAGATAGTCCTGCAGG + Intronic
1141342714 16:83217857-83217879 TTAGCAAGACATGGTCCTTAGGG + Intronic
1155685420 18:28542507-28542529 TCATCTTGATATAGTCCTGAAGG + Intergenic
1156014454 18:32532363-32532385 TTATCTTGTCATAGTCCTGGAGG - Intergenic
1157277039 18:46318441-46318463 TTGCCTAGACATAAGCCTGCTGG + Intergenic
1159461185 18:68723937-68723959 TTACAGAGGCATAGTCCTCATGG - Intronic
1160462453 18:79049144-79049166 TTACAAAAACATAGACCTGAGGG - Intergenic
929570716 2:43021321-43021343 TTGCTTAGAAAAAGTCCTGAGGG - Intergenic
941581081 2:167295391-167295413 TAACCTTAACAAAGTCCTGAAGG - Intergenic
947088766 2:226486147-226486169 CTACCTAGATATAGTCCTTAGGG - Intergenic
1169597683 20:7219142-7219164 GTTTCTAGAAATAGTCCTGAAGG - Intergenic
1169707399 20:8521138-8521160 TTACCTAGAATTAGCCCTTAAGG - Intronic
1178993993 21:37380468-37380490 TTACCTAGGAATTGGCCTGAAGG + Intronic
1179548736 21:42129391-42129413 TGACCAAGACACAGTCCTCAAGG + Intronic
949182818 3:1155061-1155083 TTACCCAGACAAGGTCCTAAGGG - Intronic
950688963 3:14640609-14640631 TTACCCAAACACAGACCTGAGGG + Intergenic
952559004 3:34567940-34567962 TTACCTAAACATAATATTGAAGG - Intergenic
958915439 3:100045312-100045334 TTTCCTAGACATAGTAATAATGG - Intronic
959168051 3:102805499-102805521 CAACCTAGACATAATCATGAAGG - Intergenic
960035258 3:113095940-113095962 TTTCCTAGAGATAGTCCCCAGGG - Intergenic
963919792 3:150894346-150894368 CTTCCTAGACATATTCCTCATGG + Intronic
965245526 3:166261973-166261995 TTACATAGACATGGTTCTCAAGG - Intergenic
969808290 4:9627712-9627734 CTACCTAGACAGAGTCCTGGGGG + Intergenic
975737499 4:77395489-77395511 TTACCTAGAGATAGTCATCCGGG + Intronic
976321663 4:83723916-83723938 TGAGCTTGACATAATCCTGAGGG + Intergenic
976927628 4:90520531-90520553 TAAGCAAGACATAGTCCTGAAGG - Intronic
981059720 4:140410043-140410065 ATGCCTACACATAATCCTGAAGG + Intronic
983880698 4:172929119-172929141 TTACCCACACATATTTCTGAAGG + Intronic
999872757 5:155769620-155769642 TAACCTTGGCATAGTCCTGGAGG + Intergenic
1007671029 6:43554000-43554022 TTCTCTAGACATAGCCCTTAAGG - Intronic
1008885025 6:56423340-56423362 TGCCCTAAACCTAGTCCTGATGG - Intergenic
1015607963 6:134979956-134979978 TTACCTAGACATAGTCCTGAAGG + Intronic
1016699916 6:147042675-147042697 TTCCATTGACATAGTCCAGATGG - Intergenic
1018281926 6:162195809-162195831 TTACCTAGAGTTTGTCCTGGAGG + Intronic
1022631786 7:32092351-32092373 TTACCTGGACCTAGCCCTGCTGG + Intronic
1022779280 7:33561770-33561792 TTACCATGACATTGTCCTGTTGG - Intronic
1024811175 7:53213931-53213953 TTACCTAGACATATTGATGAGGG + Intergenic
1026440896 7:70442851-70442873 TAACCCAGACAAAATCCTGAAGG - Intronic
1026890064 7:73976741-73976763 TTTCCTGGAGATGGTCCTGAGGG - Intergenic
1031290248 7:119925382-119925404 TTACCTAGAATGAGTTCTGAGGG + Intergenic
1033840654 7:145369910-145369932 TTACCCAGTCATGATCCTGAAGG - Intergenic
1034378594 7:150668401-150668423 TTACCTAGCCACTGTCCTGATGG + Intergenic
1039395075 8:37218725-37218747 AGACCTGGACATATTCCTGAAGG + Intergenic
1042160266 8:65886521-65886543 TTACCTAGAAATAGAACTGCTGG - Intergenic
1044801040 8:95956758-95956780 TGACATACACATAGTCCTGGTGG + Intergenic
1052452537 9:28650536-28650558 TTCCCTAGCCAAAGTCCTGTGGG + Intronic
1055896936 9:81187858-81187880 TCACCAAGACAAAGCCCTGATGG + Intergenic
1057712918 9:97463456-97463478 ATACATAGAAATAGTCCTAAAGG + Intronic
1186652637 X:11577579-11577601 TTTCCTAGACACACACCTGATGG - Intronic
1187240929 X:17512372-17512394 TTACCTAGAAAAATCCCTGAAGG + Intronic
1187691216 X:21869087-21869109 TTACATATACATTGTACTGATGG + Intronic
1201791854 Y:17849655-17849677 TTACCTAGAAATAGTGGTGTAGG + Intergenic
1201799762 Y:17942234-17942256 TTACCTAGATATAGTGGTGTAGG + Intergenic
1201801791 Y:17963722-17963744 TTACCTAGATATAGTGGTGTAGG - Intergenic
1201809700 Y:18056334-18056356 TTACCTAGAAATAGTGGTGTAGG - Intergenic
1202353457 Y:24019310-24019332 TTACCTAGAAATAGTGGTGTAGG + Intergenic
1202361776 Y:24118360-24118382 TTACCTAGAAATAGTGGTGTAGG - Intergenic
1202363296 Y:24134736-24134758 TTACCTAGAAATAGTGGTGTAGG + Intergenic
1202507484 Y:25535381-25535403 TTACCTAGAAATAGTGGTGTAGG - Intergenic
1202509001 Y:25551753-25551775 TTACCTAGAAATAGTGGTGTAGG + Intergenic
1202517322 Y:25650805-25650827 TTACCTAGAAATAGTGGTGTAGG - Intergenic