ID: 1015610562

View in Genome Browser
Species Human (GRCh38)
Location 6:135013275-135013297
Sequence TGGTGACTGGCAGAGACCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015610562_1015610566 11 Left 1015610562 6:135013275-135013297 CCGTGGGTCTCTGCCAGTCACCA 0: 1
1: 0
2: 1
3: 25
4: 231
Right 1015610566 6:135013309-135013331 TCTTTTTCTCATGTGATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015610562 Original CRISPR TGGTGACTGGCAGAGACCCA CGG (reversed) Intronic
902310777 1:15579929-15579951 TGCTGACTGACAGAGACACCTGG + Intronic
903540120 1:24092140-24092162 TCGTGAGTGGCAGAGGCCCTAGG - Intronic
903682704 1:25107699-25107721 TGGAGTCAGGCAGAGACTCATGG + Intergenic
903999498 1:27330927-27330949 TGGTGAGGGGCAGAGGGCCAGGG - Intronic
905891495 1:41521268-41521290 TGGTGCGTGGCAGAGCCCCTGGG - Intronic
907153070 1:52306789-52306811 TGCAGCCTGGCAGAGAGCCAGGG + Intronic
907161866 1:52376680-52376702 TGGTGAATAGCAGGGACTCAAGG + Intronic
908391918 1:63690984-63691006 GGGTGAAGGGCACAGACCCAGGG - Intergenic
908941566 1:69441121-69441143 TGGAGACTGCCAGAAACCCTTGG + Intergenic
910513612 1:88035365-88035387 TGGGGAGTGGCACAGAACCAGGG + Intergenic
915676747 1:157539058-157539080 GGGTGATTGGCAGGAACCCAGGG + Intronic
915686545 1:157639997-157640019 GGGTGATTGGCAGGAACCCAGGG + Intergenic
916212762 1:162372237-162372259 GAGTGCCTGGCAGTGACCCAGGG + Intronic
917062004 1:171051576-171051598 TGGGGCCTGGCAGAGAGGCAGGG + Intronic
922443332 1:225675866-225675888 TGGTGATTGGCAGGGACTCCGGG + Intergenic
923009223 1:230074942-230074964 TGCTGGCTGGCAGAAACCCTCGG - Intronic
923663842 1:235981454-235981476 TGGTGACTTGTAGATATCCACGG - Intronic
924489374 1:244520528-244520550 TTGTGGGTTGCAGAGACCCATGG - Intronic
924501937 1:244646021-244646043 TGGAGACTGGGAGAGGCCCCGGG - Intergenic
1062854187 10:771409-771431 CGGTGACTTGCATTGACCCAGGG - Intergenic
1066049834 10:31622789-31622811 TGGTGAATGGCAGCTAACCATGG + Intergenic
1069335872 10:67349527-67349549 TGGTGATTGCCAGGGACTCAAGG + Intronic
1069423680 10:68270852-68270874 TGCTGATTGTCAGAGAACCACGG + Intergenic
1069550268 10:69359461-69359483 AGCTGACATGCAGAGACCCAGGG + Intronic
1070797669 10:79226284-79226306 TGGTGACCTGCAGAGATGCAGGG - Intronic
1071165253 10:82798958-82798980 AGGTGACTGGGAGATACTCAAGG + Intronic
1073242694 10:102068507-102068529 TGGAGACAGGCAAGGACCCAGGG - Intergenic
1075517495 10:123120281-123120303 TGGTGACTCGCAGAGGGCCTGGG + Intergenic
1076178459 10:128386867-128386889 TGGTGACTGAGAGGGAACCAAGG + Intergenic
1076468422 10:130701839-130701861 AGGCCACTGGCAGAGTCCCAGGG + Intergenic
1077205221 11:1338814-1338836 TGATCGCTGGCAGAGTCCCACGG + Intergenic
1077333588 11:1993937-1993959 TGGGGACTGTCAGAGACCGAGGG - Intergenic
1083624444 11:64064941-64064963 TGGTGACTGAGACAGACTCAGGG + Intronic
1083644434 11:64164492-64164514 TTGGGGCTGGCAGAGACCCCTGG - Intronic
1084329735 11:68423420-68423442 TGGGCACTGGCGGAGACCCCTGG - Intronic
1084438016 11:69155414-69155436 TGCTGACTCCCAGAGGCCCAGGG + Intergenic
1084460837 11:69295759-69295781 TGGTGACCGGGAGAGAAACAAGG + Exonic
1086353292 11:85965728-85965750 TGTTGATGGGCAGAAACCCAAGG - Intronic
1087170098 11:95041347-95041369 AGTTGACAGGCAGAGAACCAGGG - Intergenic
1088125126 11:106415189-106415211 TGGTGACTTGGAGAGTCCCAAGG + Intergenic
1090137836 11:124217621-124217643 TGGTGTCTTACAGTGACCCAGGG - Intergenic
1090276611 11:125424506-125424528 TGGTGGCTGGCAGCAGCCCATGG + Intronic
1202816568 11_KI270721v1_random:49119-49141 TGGGGACTGTCAGAGACCGAGGG - Intergenic
1091633529 12:2180268-2180290 TGGTGTCTGGCAAAGGCCAAAGG + Intronic
1094345742 12:29466598-29466620 TGATGACTGGAAGAGGCACAAGG + Intronic
1095838046 12:46660077-46660099 TGGAGACAGGCAGATACCCCGGG - Intergenic
1096016600 12:48281914-48281936 TGGTAACTGCCAGAAACCCCTGG + Intergenic
1099960369 12:89391379-89391401 TGGGGACTGTAAGAGACCCAAGG - Intergenic
1101561720 12:105863487-105863509 TGGTTATAGGCAGAGACTCAGGG - Intergenic
1101970129 12:109307213-109307235 TGGTGAGTTGCAGTGACCCCGGG + Intronic
1102430870 12:112881885-112881907 TGGGCCCTGGCAGATACCCAGGG + Intronic
1103862867 12:124028232-124028254 TGGTGTCTGGCACAGAGCAAGGG + Intronic
1104298735 12:127543108-127543130 TGATGCCTGGCACAGAGCCAAGG + Intergenic
1104872387 12:132009326-132009348 TGATGACTGTCACAGACCCCAGG + Intronic
1105959047 13:25312188-25312210 TGGGGGCTGACAGAGACACAAGG + Intronic
1107801517 13:44112304-44112326 TGAAGACTGTCAGAGACACAAGG + Intergenic
1113408899 13:110066297-110066319 TGGGCACTGGCAGAGACAGAAGG - Intergenic
1113649789 13:112027322-112027344 GGGGGACAGGCTGAGACCCACGG + Intergenic
1113649830 13:112027434-112027456 TGGGGACAGGCTGAGACCCGGGG + Intergenic
1113779032 13:112965499-112965521 TTGTGACTGGGAGAGCCCCGCGG - Intronic
1114657224 14:24323352-24323374 TGATGAGAGGCAGAGACCCAGGG + Exonic
1117124797 14:52610866-52610888 TGGTTACTAGCAGAGACCTATGG - Intronic
1117275234 14:54187243-54187265 TGGTGACTGGCTGGGACCATGGG + Intergenic
1117344843 14:54821898-54821920 TGCTGGGTGGGAGAGACCCATGG - Intergenic
1120042209 14:79766962-79766984 TGGTAGATGGCAGAGACCCCTGG + Intronic
1121034083 14:90684723-90684745 TGGTGACTGGAAGAGGCCACGGG + Intronic
1122742532 14:103880542-103880564 TGGGGACTGGCAGAGTGCCCTGG + Intergenic
1123066874 14:105623361-105623383 GGGTGTCTGGCTGAGCCCCAGGG - Intergenic
1123075857 14:105667129-105667151 GGGTGTCTGGCTGAGCCCCAGGG - Intergenic
1125235810 15:37512238-37512260 TGATGAGTAGCAGAGACTCAGGG - Intergenic
1125676772 15:41506172-41506194 TGCTCACTGGCATAGAGCCAGGG + Intronic
1128835630 15:70807177-70807199 AGGTCACTGGCAAAGGCCCAGGG + Intergenic
1128889531 15:71318320-71318342 TGGAGACAGACAGAGAGCCAGGG + Intronic
1131183325 15:90255271-90255293 TGGTGCCTGCCAGAAACCCCTGG - Intronic
1132351328 15:101141484-101141506 TGGTGACTGGCACCACCCCATGG + Intergenic
1133698662 16:8288698-8288720 TGGTGAGTGGCAGAGCCAGACGG + Intergenic
1133815640 16:9195333-9195355 TGCTGCCCGGCAGGGACCCAGGG + Intergenic
1134674519 16:16080173-16080195 CAGTGACAGGCAGAGACGCAAGG - Intronic
1135891677 16:26363120-26363142 TGGTTAATGGCAGAGACCCGGGG + Intergenic
1135989684 16:27210431-27210453 AGGTGCCTGGCACAGACACAGGG - Exonic
1136243057 16:28956336-28956358 TGGTGAGTGCCTGAGGCCCATGG + Exonic
1136341016 16:29643397-29643419 TGTTGCCTGTCAGACACCCAAGG - Intergenic
1137636266 16:49989314-49989336 TGGTGGCTGCCAGTGACCAAAGG + Intergenic
1137719062 16:50617102-50617124 TGGCAAATGGCAGTGACCCAGGG - Intronic
1138585379 16:57966476-57966498 TGCAGACTGGCACAGATCCATGG - Intronic
1141685129 16:85565814-85565836 TGGAGCATGGCCGAGACCCAGGG - Intergenic
1141780373 16:86155743-86155765 TGGTGATTGCTAGAGACACAGGG + Intergenic
1141998897 16:87652732-87652754 TGCTGACTGCCAGAGATCCAAGG - Intronic
1142033586 16:87850479-87850501 TGGTGACTCGCAGTCACCGATGG - Intronic
1142408621 16:89904862-89904884 TCGAGGCTGGCAGAGCCCCATGG - Intronic
1142734923 17:1891259-1891281 TGGTGACTGACAGAGGCTCACGG + Intronic
1143191173 17:5041224-5041246 TGGTGGCTGGCACACACCTATGG - Intronic
1143728557 17:8866706-8866728 TGGTGCCTGGCTGAGGCTCAAGG - Intronic
1146726289 17:35159068-35159090 CAGTGACTGGCAGAGATCCAGGG - Intronic
1147446282 17:40477150-40477172 AGGTGCCTGGCGGTGACCCACGG - Exonic
1148915545 17:50974319-50974341 AGGTTAGTGGCAGAGACACAGGG + Intronic
1150132332 17:62675873-62675895 TGGTGACCAGCTGAGAGCCATGG - Exonic
1150287031 17:63960430-63960452 TGGGGTCTGGGAGAGAACCAGGG - Intronic
1150432737 17:65131538-65131560 TGGTGGCTGGGAGGGACACAGGG - Intergenic
1150477522 17:65486305-65486327 TGCTGACTGGGAGGGACCCAAGG + Intergenic
1151451555 17:74201121-74201143 CGGGGACTGTCAGAGACCAAGGG - Intergenic
1151482627 17:74379436-74379458 TGCTGGCTGGCAGGGACCAAGGG + Intergenic
1151665407 17:75542735-75542757 AGGGGACCGGCAGAGACCCCAGG + Intronic
1152200883 17:78945235-78945257 TGGTGACTGGGAGGGACTCGAGG - Intergenic
1152471148 17:80490712-80490734 TGGAGGCTGGCAGGGGCCCAGGG + Intergenic
1152885445 17:82846535-82846557 GTGAGACTGGCTGAGACCCAGGG + Intronic
1153060667 18:991609-991631 TGGTGGCTGGCAGAGGCCACTGG - Intergenic
1153233494 18:2963568-2963590 TGGAGAGTGACAGAGACCAAAGG + Intronic
1154273525 18:12940186-12940208 GTCTGACTGGCAGAGACCTATGG - Intergenic
1154385152 18:13886559-13886581 TGGGGTCAGGCAGTGACCCAGGG - Intronic
1156856165 18:41783519-41783541 TGGTGACTGTAAGAAAGCCAGGG - Intergenic
1159034854 18:63267094-63267116 GGGTGACTGGCACAGAGCCTGGG + Intronic
1159648025 18:70942969-70942991 GGGTGCCAGGCAGAGTCCCAAGG + Intergenic
1159809380 18:72998516-72998538 TGGGGACTTGCACAGCCCCAGGG + Intergenic
1160011031 18:75107236-75107258 TGATTACTGGCAGAGCACCAGGG - Intergenic
1160890759 19:1377598-1377620 TGGAGCCTGGCTGAGCCCCACGG - Exonic
1161742875 19:6034761-6034783 AGGTGGCTCGCAGAGGCCCATGG - Intronic
1165264130 19:34646295-34646317 TGGTGCCCGGGAGAGGCCCAGGG + Intronic
1166267951 19:41696598-41696620 TGGTGACAGGCAGTGACCCAGGG + Intronic
1168449879 19:56458134-56458156 TGGTGAGTGACAGAGAACCAAGG - Exonic
926213650 2:10890188-10890210 TGGTGAATGGCAGGGATCCATGG - Intergenic
929226565 2:39516898-39516920 TGCTGACAGCCAGAGACCCAAGG - Intergenic
929783165 2:44970946-44970968 TGGTGACAGGCAGAGACAAGGGG - Intergenic
930344922 2:50168151-50168173 TGATGGCAGGCAGTGACCCAGGG + Intronic
930350742 2:50251184-50251206 TGGTGCCTGTCAGGGAGCCAGGG - Intronic
934947583 2:98553009-98553031 TGGTGGCTTCCAGAAACCCAAGG - Intronic
935289513 2:101598209-101598231 TGGGGAAGAGCAGAGACCCACGG - Intergenic
935689079 2:105714202-105714224 TGGTGGCTGGTTGGGACCCAGGG - Intergenic
936500553 2:113062725-113062747 GGGTGAGTGGAGGAGACCCATGG + Exonic
937241629 2:120465847-120465869 GGGTGACTGGAAGAAAACCAGGG - Intergenic
937320831 2:120959739-120959761 GAGGGACTGGCACAGACCCATGG - Intronic
937866383 2:126754384-126754406 TGGTAACTGGCAGTGCCACAGGG + Intergenic
938400656 2:130988198-130988220 AGGTGACTGCCAGACTCCCAGGG - Intronic
946345821 2:219109638-219109660 TGGTGTCTGGCAGAGAATAAAGG + Intronic
946440857 2:219693962-219693984 TGGTGACAGGAAGAGAAGCAAGG + Intergenic
946882940 2:224194408-224194430 TGAAGACTGGCAGAGACCTAGGG + Intergenic
947191429 2:227509972-227509994 TGGTGCCTGGCACAGAACAAGGG - Intronic
948114074 2:235480754-235480776 TGGTGATTGCCAGGGACCTAGGG + Intergenic
948811459 2:240480566-240480588 TGGTGACCAGCAGAGCCCCCAGG + Intronic
948827087 2:240578057-240578079 TTGTGTCTGGCAGAGACCTGTGG + Exonic
1170855783 20:20052605-20052627 TGCTGACTAGCAGCGACGCAAGG + Exonic
1174785245 20:53426358-53426380 AGGTGACTGGGGGAGACCCTTGG + Intronic
1175302778 20:57954623-57954645 TGGTCATTGGAAGAGACACATGG + Intergenic
1176100643 20:63362941-63362963 GGGTGGGTGGCAGACACCCATGG - Intronic
1178562395 21:33651072-33651094 TGCTGCCTGGCAGACACGCAAGG + Intronic
1179316243 21:40246786-40246808 TGGAGACTGAGAGAGTCCCAGGG + Intronic
1179631297 21:42680212-42680234 TGGCGACTGTCAGTGAGCCAGGG - Intronic
1181030673 22:20147679-20147701 TGGTGGCAGGCAGAGGCCAATGG - Exonic
1181572205 22:23773738-23773760 TGGTGCCTGGAAGCGCCCCAGGG - Intronic
1182066437 22:27434729-27434751 GGGTGACTGGTGGATACCCATGG - Intergenic
1182070197 22:27458142-27458164 TGGTCACTGGGAAAGACCCCTGG - Intergenic
1182662927 22:31937649-31937671 AGTTGCCTGGCAGAGAACCATGG + Intronic
1184231110 22:43158968-43158990 GGGTCAGTGCCAGAGACCCAAGG + Intronic
1184247971 22:43245238-43245260 TGCTGACTGTCAGAGGCGCAAGG - Intronic
1184622208 22:45689376-45689398 CAGTAACTGGCAGAGACACAAGG - Intronic
949333664 3:2950118-2950140 TGTGGACTTGCAGAGACTCATGG + Intronic
950380016 3:12604832-12604854 TGGTGACTGGAAGAGGCCAGTGG - Intronic
953993627 3:47502889-47502911 TGGTGAGTGGCAGTGGCCTAAGG + Intronic
954364022 3:50136902-50136924 TCCTGACAGGCAGTGACCCAGGG - Intergenic
955106383 3:55902654-55902676 TGATGACTGGAAGAGAGGCAAGG - Intronic
959462090 3:106639741-106639763 TGGTAATTTGCAGAAACCCAGGG - Intergenic
961219948 3:125191843-125191865 TGGAGACTGACGGAGACACAAGG - Intronic
961461557 3:127053326-127053348 TGGTGAGTGGCAGGGCCCCTGGG - Intergenic
963285405 3:143430359-143430381 AAGTGACTGCCAGAGTCCCAAGG + Intronic
966757699 3:183386867-183386889 TGCTGACTCAGAGAGACCCACGG + Intronic
968747025 4:2365445-2365467 GGGTGACTGGCGCAGACCCTGGG - Intronic
969108395 4:4825646-4825668 GGCTGACATGCAGAGACCCAGGG - Intergenic
969166311 4:5318889-5318911 AGGTGAATGGCATAAACCCAGGG - Intronic
971106662 4:23532991-23533013 TTGTGAGTGGCAGAGATCAAGGG + Intergenic
972828385 4:42787162-42787184 TGGGGACTGGCGCAGACCCCTGG - Intergenic
976429398 4:84945495-84945517 TGGTGATGGGCAGATGCCCAGGG + Intronic
976494575 4:85712603-85712625 TGGTGACTGTCAGCAACCCTTGG + Intronic
977650355 4:99461838-99461860 TGGTGATTGATAAAGACCCAGGG - Intergenic
978282726 4:107036625-107036647 TGGAAACTGGCAGAGACCAAAGG + Intronic
980167121 4:129242426-129242448 AGCTGGCTGGCAGAGAACCATGG + Intergenic
981722286 4:147813671-147813693 AGGTTAATGGCAGAGGCCCAGGG + Intronic
982247379 4:153366771-153366793 TTGTGCCTGGCAGTGAACCATGG + Intronic
983294208 4:165845115-165845137 TGGTGTCTGTCAGAGATGCATGG - Intergenic
983536985 4:168868274-168868296 TTGTGACTGGCAGACCCACAAGG + Intronic
985600240 5:824878-824900 TGGTGATGGGCAGATGCCCAAGG - Intronic
986645159 5:9910151-9910173 TGGTGGCTTGCAGAGGCCCTGGG + Intergenic
986649420 5:9948875-9948897 TGGTGTTTGGCAGAGACTGAAGG + Intergenic
987668342 5:20975178-20975200 TGATGACTGGAAGAGCACCAGGG + Intergenic
988113074 5:26848551-26848573 TACTGACTGGCAGAGACTCCAGG + Intergenic
992157335 5:73968316-73968338 TGGTGCCTGGCCCAGACCCAAGG - Intergenic
992986544 5:82236478-82236500 TGGAGACTGTCAGAAGCCCAGGG + Intronic
995181116 5:109231159-109231181 GGGTCATTGGCTGAGACCCATGG + Intergenic
995736855 5:115310781-115310803 TGCTGAATAGCAGAGACACAGGG - Intergenic
997676175 5:135714820-135714842 TGGTGAGTGGAAGAGCCCTATGG + Intergenic
997839795 5:137228950-137228972 TGGTTACTGGAAGCCACCCAGGG - Intronic
998038890 5:138938264-138938286 TGGTGACGGGCAGGGAACCGTGG - Intergenic
998590318 5:143471325-143471347 TGGAGACTGGCAGGGATCCTTGG + Intergenic
999259289 5:150228099-150228121 GGGTGACGGGCAGGGCCCCAGGG - Intronic
999379172 5:151108434-151108456 TGGTAACTGGCAGGGACTAAGGG - Exonic
999641168 5:153674640-153674662 GGTGGACTGGAAGAGACCCAAGG + Exonic
1001643129 5:173259706-173259728 AGGCAAATGGCAGAGACCCATGG + Intergenic
1001883867 5:175270858-175270880 TGGAGACTGTCAGAGCCCGAAGG + Intergenic
1001945818 5:175777159-175777181 TGGTGGCAGGCGGAGCCCCAAGG - Intergenic
1002071202 5:176679842-176679864 TGGTAGCTGGCAGAGCCCCAGGG - Intergenic
1002524091 5:179806192-179806214 CGGAGAGGGGCAGAGACCCAAGG - Intronic
1015610562 6:135013275-135013297 TGGTGACTGGCAGAGACCCACGG - Intronic
1018217145 6:161539465-161539487 TTTTCACTGGCAGAGACCGAGGG - Intronic
1018620484 6:165725554-165725576 TGCTGACTGGCAGGAACCGATGG - Intronic
1019743515 7:2687587-2687609 TGGTGGCTGGCACAGGGCCAGGG + Intronic
1020344606 7:7149409-7149431 TGGTGACTGTAAGAGACTAATGG - Intergenic
1020434084 7:8143575-8143597 AGGTCACAGGCAGAGAGCCAGGG + Intronic
1023991889 7:45133452-45133474 TGGTGACTGCCACAGGCCCTGGG + Intergenic
1026950259 7:74342042-74342064 TCGTGCCAGGCAGAGACCCATGG + Intronic
1028940679 7:96519171-96519193 TAGTGACTGGCAGAGAGGAATGG + Intronic
1029179388 7:98689007-98689029 TGGCAACTGACAGAGGCCCAGGG + Intergenic
1029578815 7:101421203-101421225 GGCTGGCTGGCTGAGACCCAGGG + Intronic
1030260786 7:107562223-107562245 TGGAGAATGGCAGAGAACCAAGG + Intronic
1033116246 7:138628243-138628265 TGGTGACTGGGGGGGACTCAGGG - Exonic
1033436880 7:141341198-141341220 TGGAAACTGGCAGAGACAAAAGG + Intronic
1034051270 7:147986709-147986731 TGTTGATAGGCAGAGACCCAAGG - Intronic
1034265137 7:149777091-149777113 TGGTTTCAGGCAGAGAACCAGGG + Intergenic
1034378115 7:150664571-150664593 TGTTGACTTGCAGAGACTGAGGG - Intergenic
1036397443 8:8381339-8381361 TGGTGACTGGCTGGCAGCCAGGG - Intronic
1036567826 8:9952665-9952687 TGGTGACTAGAAGAGAACCTGGG - Intergenic
1036618837 8:10409461-10409483 TGGTGAGTGGTTGAGAACCATGG + Intronic
1037910586 8:22741552-22741574 TGGGTACTGACAGAGCCCCAGGG + Intronic
1038535060 8:28347740-28347762 GGGTGGCCGGGAGAGACCCAGGG - Exonic
1039725486 8:40211257-40211279 ACGGAACTGGCAGAGACCCATGG + Intergenic
1040285752 8:46099628-46099650 TGCTGGCTGGCAGAAACTCATGG + Intergenic
1040312912 8:46246018-46246040 GGGTGAGTCGCAGGGACCCAGGG + Intergenic
1040322983 8:46327863-46327885 TGTTGGCTGGCAGAAACTCAGGG - Intergenic
1040328470 8:46374208-46374230 TGGTGACCGGCAGAAACTCAGGG - Intergenic
1040546349 8:48401065-48401087 TGGTGAAAGGCGGGGACCCAGGG + Intergenic
1042852045 8:73226229-73226251 TGGTGATGGGCAGTGACACATGG + Intergenic
1042867060 8:73365601-73365623 TGTTGCCTGGCAGAGACGCCTGG - Intergenic
1043083833 8:75801847-75801869 TGAGGACAGGCAGAGACACAGGG + Intergenic
1044736645 8:95285700-95285722 TAGTGACTTGCTGAGGCCCAAGG - Intergenic
1045507754 8:102790688-102790710 TGGTGAGTGACAGACACCCCTGG + Intergenic
1049816799 8:144607368-144607390 TGGTGACGGGGAGGGACCCACGG + Intergenic
1052318752 9:27144401-27144423 TGGGGACTGGTAGGGGCCCATGG + Intronic
1056811186 9:89765334-89765356 TGGTGACTGGGACAGTACCAAGG - Intergenic
1057827170 9:98380203-98380225 TGGTGACTCGCAGAGGCTGAGGG + Intronic
1057887130 9:98838421-98838443 TAGTGTGTGGCTGAGACCCAGGG - Intronic
1058013452 9:100003882-100003904 TGGAGACTGGCCTAGAACCAGGG + Intronic
1059196098 9:112372575-112372597 TGGTGGCTGCCAGAGGCCAAGGG - Intergenic
1059430511 9:114247458-114247480 TAGAGACTGACAGAGACCCCGGG + Intronic
1060020930 9:120130461-120130483 TCTAGACTGCCAGAGACCCATGG - Intergenic
1060235672 9:121860945-121860967 GGGTGACTGGCATGGAGCCATGG + Intronic
1061276380 9:129571295-129571317 TGGGGACTGAATGAGACCCAGGG - Intergenic
1062143905 9:134978482-134978504 TGTTGACGGGCAGGGCCCCACGG - Intergenic
1062708324 9:137957423-137957445 TGGGGACTGGGAGGGACCCAAGG + Intronic
1187731080 X:22255578-22255600 TGGTGGCTGCCAGAGACTGAGGG - Intergenic
1188093686 X:25995090-25995112 TGGTCAGTGGCAGGGAGCCATGG - Intergenic
1188260380 X:28016317-28016339 CAGTGACTGGAAAAGACCCAGGG + Intergenic
1189661366 X:43303304-43303326 GAGTACCTGGCAGAGACCCATGG + Intergenic
1190525415 X:51324887-51324909 TAGTGACTTTCAGAGACACAGGG + Intergenic
1192709795 X:73567891-73567913 TGGTGACATACAGAGAGCCAGGG - Intronic
1195265388 X:103174648-103174670 TAGGGACTGGCTGAGACTCAGGG - Intergenic
1196169231 X:112569133-112569155 TGGAGACTGACTGAGACCCATGG + Intergenic
1199784929 X:151096516-151096538 TGATGACTTGCAAAGAGCCAAGG + Intergenic
1199855671 X:151756890-151756912 TGGGGACTCGCAGAGTCTCAAGG + Intergenic
1199862516 X:151814724-151814746 TGCAGACTGGCACAGATCCATGG + Intergenic
1200094711 X:153651905-153651927 TGGGGACTAGAAGAGCCCCATGG + Intergenic