ID: 1015613183

View in Genome Browser
Species Human (GRCh38)
Location 6:135047980-135048002
Sequence CCCTGAATAAGGAGCTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015613179_1015613183 11 Left 1015613179 6:135047946-135047968 CCTAAGTCACTACAAAATGTCTT 0: 1
1: 1
2: 2
3: 17
4: 239
Right 1015613183 6:135047980-135048002 CCCTGAATAAGGAGCTATAAAGG 0: 1
1: 0
2: 0
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015613183 Original CRISPR CCCTGAATAAGGAGCTATAA AGG Intronic
905135481 1:35796031-35796053 CCCTGATTAAGGAGCCAGATAGG - Intergenic
907585379 1:55612199-55612221 CCATAAATAAGCAGATATAAGGG - Intergenic
908635316 1:66157343-66157365 CACTGCAAAAGGAGCTAGAAAGG - Intronic
911844002 1:102725505-102725527 CTCTGAAAATGGAGGTATAATGG - Intergenic
915438412 1:155927127-155927149 CCCTGAACATGAAGATATAATGG + Exonic
919317467 1:195991367-195991389 CATTTAATTAGGAGCTATAAGGG + Intergenic
920547617 1:206831547-206831569 TCCTGATTTAGGAGCTCTAAAGG + Intronic
1069482555 10:68797054-68797076 CCCTGAAGAAAAAGCTCTAATGG - Intergenic
1073985207 10:109200532-109200554 CCATGAAGCAGGAGCTGTAAAGG - Intergenic
1078353831 11:10618497-10618519 CCCTGAATAATGAGCTCCAGAGG - Intronic
1084397652 11:68924042-68924064 CCCTGAATAACGAGAGACAAAGG - Intronic
1084900083 11:72303130-72303152 ACCTGATTAGGGAGCTGTAAAGG + Intronic
1085783649 11:79432738-79432760 CCCAGAAAAAGGACCTCTAAAGG + Intronic
1088680054 11:112232269-112232291 CCCTGCATAAGAGGCTTTAATGG + Intronic
1090451899 11:126813724-126813746 TTCTGAATAAGAAGCTTTAAGGG - Intronic
1092836390 12:12493087-12493109 CCCTGAAGGAGGAGGTATAAAGG - Intronic
1094522580 12:31208570-31208592 GCGTGGATAAGGAGCTATACAGG - Intergenic
1095253490 12:40005618-40005640 CCCTGAATCAGTAGGTCTAACGG - Intronic
1096940394 12:55338310-55338332 CCATGAATAATGAGCCTTAAAGG + Intergenic
1100326564 12:93545088-93545110 CCCTAAATAAGAAGTCATAAAGG - Intergenic
1100783281 12:98052296-98052318 TCCTTAATAAGCAGGTATAAGGG + Intergenic
1101179055 12:102190611-102190633 CCTTGAAACAGGATCTATAAAGG + Intronic
1104804191 12:131574510-131574532 TCCTGAATAAGCAGCCATAAAGG + Intergenic
1108686491 13:52823923-52823945 CTCTGAATACGCATCTATAATGG + Intergenic
1108924492 13:55723717-55723739 CCCAGAATAAGAAGTAATAATGG + Intergenic
1120122020 14:80692571-80692593 CACTGACTAAGGAGATATAATGG - Intronic
1120144010 14:80959480-80959502 CTCTGAATAAGGAGGTAGAAAGG + Intronic
1120976508 14:90253748-90253770 CCATGAAGGAGGAACTATAAAGG + Intergenic
1126034122 15:44531647-44531669 CTCTTAAAAAGAAGCTATAAAGG + Intergenic
1128667555 15:69549538-69549560 CCCTGCATAAGGAGCTATGGAGG + Intergenic
1137941517 16:52692723-52692745 TCCTAATTAAGGAACTATAAGGG + Intergenic
1139834594 16:69828133-69828155 CCCTGAATCAAGAGAAATAAGGG + Intronic
1141863203 16:86732018-86732040 CACTGAAAAAGGAGTTATAGTGG + Intergenic
1147494954 17:40906761-40906783 ACCTCAATGAAGAGCTATAAAGG + Intergenic
1149785557 17:59431782-59431804 CCCTGAAAGAGGAGCCAGAATGG + Intergenic
1150063287 17:62087451-62087473 TCCTGAAAATGTAGCTATAAAGG + Intergenic
1153962846 18:10154050-10154072 CACAGAATTATGAGCTATAATGG + Intergenic
1155976487 18:32137341-32137363 TCCTGCATAAGGAGGTACAATGG - Intronic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
931473737 2:62566949-62566971 CTCTGAACAAGGAGTTATAATGG + Intergenic
932795220 2:74688988-74689010 CCTTGAATTATGAGCTTTAAGGG - Intergenic
940448752 2:153811685-153811707 CTCTAAATAAGGAGCCACAAGGG - Intergenic
940603565 2:155891419-155891441 CTATGATTTAGGAGCTATAATGG - Intergenic
941758554 2:169215165-169215187 CTCCGAATATGGACCTATAATGG - Intronic
943874909 2:193053880-193053902 GCCTGTATAAGAAACTATAACGG - Intergenic
1175544035 20:59766555-59766577 GCCTGAATCAGCAGCTAGAAAGG + Intronic
1178989370 21:37339808-37339830 CCCTCAAATAGGAGCTAAAAAGG + Intergenic
1179318381 21:40267511-40267533 CCCTTAAGATGGAGCTATAATGG - Intronic
1183402753 22:37614205-37614227 CCCTGAACAAGGAGCTCGACTGG + Exonic
1184032695 22:41904291-41904313 CCCTGAAGACTGAGATATAAAGG + Intronic
1185187962 22:49414185-49414207 CCCATAACAAGGAGCGATAATGG + Intergenic
949549024 3:5096866-5096888 CCTAGAAAAAGGGGCTATAAAGG + Intergenic
950196028 3:11009791-11009813 CCCTGGAGAAGGTGCTCTAATGG - Intronic
950568758 3:13787334-13787356 CCCTGACTTAGGACCTATATAGG - Intergenic
951421537 3:22491871-22491893 CACTGAATGAGGTGCTATGATGG - Intergenic
957959619 3:87232432-87232454 TCCAGAATAAGGAGCACTAAAGG - Intronic
959969175 3:112389488-112389510 CCGTGAATAATGAGCCTTAAAGG - Intergenic
960853774 3:122082024-122082046 CCAGGAATAAGGAGAAATAAAGG - Intronic
965358043 3:167701652-167701674 CCATGTATAATGAGCTTTAAAGG - Intronic
966317087 3:178659792-178659814 CCATTTATAAGGAACTATAATGG - Intronic
967442828 3:189528591-189528613 CTATGAATAAGGAGCTAGACTGG - Intergenic
969903337 4:10370353-10370375 CCATGAACAAGGAGCTATGGAGG - Intergenic
970200377 4:13598982-13599004 CCCTGAGGAAGGAGACATAATGG - Exonic
974222718 4:58997284-58997306 CCATGAATAATGATCTAGAATGG + Intergenic
978300054 4:107258130-107258152 CCCTGGATAAGTAGATATATTGG - Intronic
982616343 4:157641347-157641369 CCATGAAATAGGAGCTGTAAAGG - Intergenic
982764452 4:159328019-159328041 AACTGAATAAGTAGATATAAGGG - Intronic
984482112 4:180318776-180318798 CTCTTTATTAGGAGCTATAATGG - Intergenic
987767098 5:22246743-22246765 CTCTCAATAAGGACCTATGATGG + Intronic
989433808 5:41386994-41387016 CCCTGAATAACCAGAAATAAAGG - Intronic
991158920 5:63471967-63471989 CCCTGAATAAATAGTAATAAAGG - Intergenic
993437140 5:87911836-87911858 CCCAGAATCAAAAGCTATAATGG + Intergenic
996638772 5:125728354-125728376 GACTGAATAAGGAGACATAAAGG + Intergenic
998387114 5:141763750-141763772 CCCTTAATTAGGAGCTAAAGTGG - Intergenic
999394499 5:151218554-151218576 GCCTGGAAAAGGAGCTCTAAGGG - Intronic
999634502 5:153606841-153606863 AACTGAATAAGGAGATATTATGG - Intronic
1000892576 5:166816984-166817006 CACTGAACATTGAGCTATAAAGG - Intergenic
1001917653 5:175575126-175575148 TCCTGAAATAGGAGCTATCAGGG + Intergenic
1007150221 6:39683152-39683174 CCCTGTTTAAAGTGCTATAAAGG - Intronic
1008864541 6:56193718-56193740 CTCTGCATAAAGAGTTATAAAGG + Intronic
1011704610 6:89988519-89988541 ACCTGTCTAAGGAGCTATTAAGG - Intronic
1011999944 6:93641796-93641818 CCCTGAGTAATGAGCCTTAATGG + Intergenic
1013858713 6:114607455-114607477 CCCTGAATCAGGACTGATAATGG + Intergenic
1015613183 6:135047980-135048002 CCCTGAATAAGGAGCTATAAAGG + Intronic
1018340673 6:162847767-162847789 ACCTGAACAAGGAGCTACTAGGG + Intronic
1023103249 7:36739933-36739955 CCCTTCCTAAGGAGCTAGAATGG + Intergenic
1023364687 7:39451914-39451936 CCCTGAATTAGTGGCTATCAAGG + Intronic
1023497907 7:40817382-40817404 CCCTGAATAAGCAGTGATAGAGG + Intronic
1029640938 7:101818498-101818520 CCCTGAAGAAGTAGCTAATATGG - Intronic
1032904674 7:136350301-136350323 TCCTGAATGAGGAGCTCTAAGGG + Intergenic
1033897513 7:146092384-146092406 CACTGAATAAGGAGTTACAAAGG - Intergenic
1037603547 8:20419099-20419121 CCCGGAACACGGAGCTATTAAGG + Intergenic
1041494053 8:58466526-58466548 TCCTAAATGAAGAGCTATAAAGG - Intergenic
1043686876 8:83097601-83097623 CCCAAAATAAAGAGCTACAAAGG - Intergenic
1043834148 8:85027440-85027462 CCTTGAATAAGCAGGTAAAATGG - Intergenic
1055892952 9:81142545-81142567 CCCTGAAGGAGAAGCTATACTGG - Intergenic
1056931085 9:90877896-90877918 CCCTGAGTATGGACCAATAAAGG - Intronic
1191061444 X:56301837-56301859 AGCGGAATAAGGAGCTATGAGGG - Intergenic
1192585900 X:72317945-72317967 CCCTGAATATGGCCCCATAAGGG + Intergenic
1193576807 X:83209274-83209296 CCCTGAGAATGGAGCTTTAAGGG - Intergenic
1193625348 X:83813568-83813590 TCCTGAATGAGGAGCTGAAATGG + Intergenic
1194722558 X:97357384-97357406 CCCTGAATAAGGCAGTAGAAGGG + Intronic
1197881021 X:131166566-131166588 CCATGAATTAAGAGCTATTATGG + Intergenic
1199425783 X:147699226-147699248 CCCTGAGTAGAGAGCAATAATGG - Intergenic
1199884405 X:152005196-152005218 CCCTCAACAAGGAGCTCTCAGGG - Intergenic