ID: 1015615574

View in Genome Browser
Species Human (GRCh38)
Location 6:135071020-135071042
Sequence ATAAGCAATATGTTCAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015615573_1015615574 -6 Left 1015615573 6:135071003-135071025 CCGTTTCAAAGTTGTTTATAAGC 0: 1
1: 0
2: 4
3: 31
4: 330
Right 1015615574 6:135071020-135071042 ATAAGCAATATGTTCAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015615574 Original CRISPR ATAAGCAATATGTTCAAATT TGG Intronic
No off target data available for this crispr