ID: 1015621851

View in Genome Browser
Species Human (GRCh38)
Location 6:135140054-135140076
Sequence CACTTAAACCCGGCAGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015621843_1015621851 9 Left 1015621843 6:135140022-135140044 CCCAGCTACTCAGGAGGCTGAGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
Right 1015621851 6:135140054-135140076 CACTTAAACCCGGCAGGTGGAGG No data
1015621845_1015621851 8 Left 1015621845 6:135140023-135140045 CCAGCTACTCAGGAGGCTGAGGC 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
Right 1015621851 6:135140054-135140076 CACTTAAACCCGGCAGGTGGAGG No data
1015621841_1015621851 17 Left 1015621841 6:135140014-135140036 CCTGTAATCCCAGCTACTCAGGA 0: 53511
1: 140483
2: 228049
3: 201895
4: 144651
Right 1015621851 6:135140054-135140076 CACTTAAACCCGGCAGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015621851 Original CRISPR CACTTAAACCCGGCAGGTGG AGG Intergenic
No off target data available for this crispr