ID: 1015625877

View in Genome Browser
Species Human (GRCh38)
Location 6:135181012-135181034
Sequence CCCGGGAGCGGGGTTTGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015625861_1015625877 28 Left 1015625861 6:135180961-135180983 CCAGGGAGGAGGGGAGGCGGCGG No data
Right 1015625877 6:135181012-135181034 CCCGGGAGCGGGGTTTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015625877 Original CRISPR CCCGGGAGCGGGGTTTGCTC AGG Intergenic
No off target data available for this crispr