ID: 1015626009

View in Genome Browser
Species Human (GRCh38)
Location 6:135181515-135181537
Sequence TGGCCCGAAGACCCCGGCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015625998_1015626009 15 Left 1015625998 6:135181477-135181499 CCCGCGGCTCTCGGCGGAGCCCC 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1015626009 6:135181515-135181537 TGGCCCGAAGACCCCGGCACAGG 0: 1
1: 0
2: 0
3: 6
4: 100
1015626001_1015626009 -4 Left 1015626001 6:135181496-135181518 CCCCGCGCCCGCCGCGCCATGGC 0: 1
1: 0
2: 6
3: 29
4: 239
Right 1015626009 6:135181515-135181537 TGGCCCGAAGACCCCGGCACAGG 0: 1
1: 0
2: 0
3: 6
4: 100
1015625994_1015626009 26 Left 1015625994 6:135181466-135181488 CCGGTGCGGTCCCCGCGGCTCTC 0: 1
1: 0
2: 0
3: 13
4: 96
Right 1015626009 6:135181515-135181537 TGGCCCGAAGACCCCGGCACAGG 0: 1
1: 0
2: 0
3: 6
4: 100
1015625999_1015626009 14 Left 1015625999 6:135181478-135181500 CCGCGGCTCTCGGCGGAGCCCCG 0: 1
1: 0
2: 2
3: 8
4: 134
Right 1015626009 6:135181515-135181537 TGGCCCGAAGACCCCGGCACAGG 0: 1
1: 0
2: 0
3: 6
4: 100
1015625993_1015626009 27 Left 1015625993 6:135181465-135181487 CCCGGTGCGGTCCCCGCGGCTCT 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1015626009 6:135181515-135181537 TGGCCCGAAGACCCCGGCACAGG 0: 1
1: 0
2: 0
3: 6
4: 100
1015626003_1015626009 -6 Left 1015626003 6:135181498-135181520 CCGCGCCCGCCGCGCCATGGCCC 0: 1
1: 1
2: 5
3: 46
4: 424
Right 1015626009 6:135181515-135181537 TGGCCCGAAGACCCCGGCACAGG 0: 1
1: 0
2: 0
3: 6
4: 100
1015626002_1015626009 -5 Left 1015626002 6:135181497-135181519 CCCGCGCCCGCCGCGCCATGGCC 0: 1
1: 0
2: 5
3: 42
4: 291
Right 1015626009 6:135181515-135181537 TGGCCCGAAGACCCCGGCACAGG 0: 1
1: 0
2: 0
3: 6
4: 100
1015625997_1015626009 16 Left 1015625997 6:135181476-135181498 CCCCGCGGCTCTCGGCGGAGCCC 0: 1
1: 0
2: 0
3: 12
4: 125
Right 1015626009 6:135181515-135181537 TGGCCCGAAGACCCCGGCACAGG 0: 1
1: 0
2: 0
3: 6
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015626009 Original CRISPR TGGCCCGAAGACCCCGGCAC AGG Exonic
900477218 1:2881648-2881670 TGGCCAGAGGGCCCCGGCAGTGG - Intergenic
900574188 1:3374909-3374931 TGGCCCGAAGTGGCCGCCACAGG + Intronic
901816281 1:11795195-11795217 TGGCCAGAAGCTCCTGGCACAGG + Exonic
907387960 1:54138075-54138097 TGCCCCGAAGCCCCTGGAACAGG + Intronic
909223928 1:72992827-72992849 TGGACCCAAAACTCCGGCACTGG - Intergenic
919879748 1:201893737-201893759 TGGCCCCAAAACCCTGGCCCAGG - Intergenic
920347225 1:205314165-205314187 TGGCCCGGTCACCCCGGCAACGG + Intronic
920502908 1:206496741-206496763 GGGCCCCAAGACACTGGCACTGG - Exonic
922906126 1:229175071-229175093 TGGACCCAAAACTCCGGCACTGG + Intergenic
1071960825 10:90808030-90808052 TGGACCCAAAACCCCGGCGCCGG + Intronic
1075513125 10:123088145-123088167 TGGCCCCATGACCCATGCACTGG - Intergenic
1075859505 10:125662403-125662425 TGGCCCTAAGACCACGGGAAGGG + Intronic
1083656879 11:64234305-64234327 AGGCCCGACGCCCCCGGCCCCGG + Intergenic
1086042431 11:82495390-82495412 TGGCCCCAAGTCCTCTGCACAGG + Intergenic
1093370268 12:18356367-18356389 TGGCCCGTACACCCAGTCACCGG - Intronic
1097712622 12:62933346-62933368 TGGCCCGGATACCCCGGGGCAGG - Intronic
1098628788 12:72703965-72703987 TGGACCCAAAACTCCGGCACCGG + Intergenic
1105854486 13:24362076-24362098 TCTCCCCAAGACCCAGGCACGGG + Intergenic
1107534158 13:41311613-41311635 AGGCCCGAGGACCCGGGGACCGG - Intronic
1109343341 13:61089169-61089191 TGGACCCAAAACTCCGGCACCGG + Intergenic
1110765190 13:79274791-79274813 TGGACCCAAAACTCCGGCACCGG + Intergenic
1113660428 13:112103722-112103744 TGGCTCGAAGACCCCGCCCTGGG + Intergenic
1119560537 14:75585765-75585787 TGGACCCAAAACTCCGGCACCGG - Intronic
1120539807 14:85737864-85737886 TGGACCCAAAACTCCGGCACCGG - Intergenic
1122940301 14:104978182-104978204 TGGCCCGGAACCCCCGGCAGCGG - Exonic
1123018112 14:105385079-105385101 TGGGCCGCAGAGCCCTGCACCGG + Intronic
1128364101 15:66984820-66984842 TGGCCCCTAGACCCCAGCTCAGG - Intergenic
1129457981 15:75685766-75685788 TGGCCCTAAGAAGCCGGAACAGG + Intronic
1132262730 15:100440911-100440933 TGGACCCAAAACTCCGGCACTGG + Intronic
1132724904 16:1334294-1334316 TCCCCCGGAGACCCCGGCCCAGG - Intronic
1133205147 16:4228775-4228797 AGGCCTGAAGACCCCGGGGCTGG + Intronic
1137851678 16:51752072-51752094 TGGCCCTCTGGCCCCGGCACTGG + Intergenic
1138115786 16:54359270-54359292 TGGCCCCATGACCCCAGCATGGG - Intergenic
1140476652 16:75242469-75242491 GGGCACGAAGCCCCCGGCAAAGG - Exonic
1141710600 16:85696789-85696811 TGTCCGGAAGAGCCAGGCACAGG + Intronic
1142272908 16:89100225-89100247 TGGCCTGGAGACCCCGCCCCCGG - Intronic
1142348642 16:89569931-89569953 TGGCCTGAGGACACCGGCCCCGG + Intergenic
1147322508 17:39654673-39654695 TGGCCCGATGACCTCAGCAAGGG + Intronic
1151326520 17:73383276-73383298 TGCCCAGAAGACCACGGCAAGGG - Intronic
1151432051 17:74070288-74070310 TGGCCAGAAGACCAAGGCAGAGG + Intergenic
1152206503 17:78977257-78977279 TGGCCCGAGGCCCCAGGGACTGG + Intronic
1157778966 18:50420659-50420681 TGGCCAGAAAACACCGGCAGGGG + Intergenic
1159304072 18:66616574-66616596 TGGCCCCAAGTCCACTGCACCGG - Intergenic
1162209074 19:9077417-9077439 TGGCCGGAAGACACCTGCCCTGG - Intergenic
1163900554 19:20096011-20096033 TGGACCCAAAACTCCGGCACCGG - Intronic
1167818484 19:51904961-51904983 TGGCCCTTAAACCCCGGCACTGG + Exonic
1168475639 19:56673289-56673311 TGGGCCCAAGAGCCCAGCACTGG + Intergenic
925434047 2:3820620-3820642 TGGACCCAAAACTCCGGCACCGG - Intronic
927857696 2:26537609-26537631 TGGCCCCAAATCCCAGGCACTGG - Intronic
929033629 2:37671574-37671596 TAGCCCGGAGACCCGGCCACCGG - Exonic
931042427 2:58314859-58314881 TGGACCCAAAACTCCGGCACCGG + Intergenic
932854463 2:75218744-75218766 TGGACCCAAAACTCCGGCACCGG - Intergenic
944167948 2:196743117-196743139 TGGCCCCAGGATCCCGGCAAGGG - Intronic
944876396 2:203966952-203966974 TGGACCCAAAACTCCGGCACCGG - Intergenic
1170413961 20:16120623-16120645 TGGCCCGAAGTCCACGGGACTGG - Intergenic
1170835296 20:19878697-19878719 TGGCACGAAAACCCAGACACAGG + Intergenic
1172742396 20:37179277-37179299 TGGCTCCAAGAGCCCGCCACAGG - Exonic
1172932784 20:38598062-38598084 TGGACCCAAAATCCCGGCACCGG - Intergenic
1175973404 20:62698574-62698596 TGGGCAGAAGACCAGGGCACGGG - Intergenic
1179155594 21:38848406-38848428 CAGCCAGAAGACTCCGGCACAGG + Intergenic
1179247259 21:39644827-39644849 TGACTGGAAGACCCCAGCACTGG + Intronic
1179387260 21:40955511-40955533 TGGACCCAAAACTCCGGCACCGG + Intergenic
1179610172 21:42545151-42545173 TGGCCAGAGGACCCAGGGACAGG - Intronic
1181629150 22:24141461-24141483 TGTCCTGGAGACCCCGGCACAGG - Intronic
1182699265 22:32220992-32221014 TGTTCCGAAGAACCCAGCACAGG + Exonic
1185008378 22:48299263-48299285 GGGCCCGTAGAGGCCGGCACAGG - Intergenic
1185272353 22:49935247-49935269 CGGACCGAAGACCCGGGCGCCGG - Intergenic
952359385 3:32614579-32614601 TTGCCCCAAGAACCCTGCACTGG + Intergenic
952791775 3:37206139-37206161 TGGACCCAAAACTCCGGCACAGG + Intergenic
954375632 3:50192845-50192867 AGTCCCCAAGACCCCGGCACAGG - Intronic
961165006 3:124757431-124757453 TGGACCCAAAACTCCGGCACCGG - Intergenic
961439161 3:126942127-126942149 TGGCAGGAAGACCCCAGAACTGG + Intronic
961711895 3:128834183-128834205 TGGACCCAAAACTCCGGCACCGG - Intergenic
969690665 4:8702425-8702447 TGGGACCAAGACCCCAGCACTGG - Intergenic
970041852 4:11807047-11807069 TGGACCCAAAACTCCGGCACCGG + Intergenic
972071331 4:35021541-35021563 TGGACCCAAAACTCCGGCACAGG - Intergenic
974223210 4:59003256-59003278 TGGCCCCATGACACCTGCACAGG - Intergenic
976226025 4:82796554-82796576 GAGCCCCAAGACCCTGGCACTGG - Intronic
976696265 4:87922543-87922565 TGGACCGAAAACTCCGGCGCCGG + Intergenic
984823701 4:183906178-183906200 CGGCCCGCAGTCCCCGGCGCTGG - Exonic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1007714889 6:43850306-43850328 TGGCCCCTAGACCCTGGCTCAGG + Intergenic
1015626009 6:135181515-135181537 TGGCCCGAAGACCCCGGCACAGG + Exonic
1016650631 6:146455712-146455734 TGGACCCAAAACTCCGGCACCGG - Intergenic
1020278256 7:6637389-6637411 CGGCCCGCAGGCCCCGGCCCCGG + Exonic
1024165166 7:46723362-46723384 TGGCCAGAAAACCCTGGCAGGGG - Intronic
1027851684 7:83460406-83460428 TGGACCCAAAACTCCGGCACGGG + Intronic
1029689232 7:102169797-102169819 TGTCCCGCAGCCCCCAGCACTGG + Intronic
1031365009 7:120890658-120890680 TGGACCTAAAACTCCGGCACTGG - Intergenic
1031399671 7:121316121-121316143 TGGACCCAAAACTCCGGCACCGG + Intergenic
1034085063 7:148314880-148314902 TGGACCCAAAACTCCGGCACCGG - Intronic
1036071178 8:5441573-5441595 TGGACCTAAAACTCCGGCACCGG - Intergenic
1036281202 8:7403032-7403054 TGGACCCAAAACTCCGGCACTGG + Intergenic
1036340264 8:7908540-7908562 TGGACCCAAAACTCCGGCACTGG - Intergenic
1043597651 8:81903261-81903283 TGGACCCAAAACTCCGGCACTGG - Intergenic
1047829791 8:128616853-128616875 TGGACCCAAAACTCCGGCACCGG - Intergenic
1048135220 8:131741455-131741477 TGGACCCAAAACTCCGGCACTGG + Intergenic
1049617650 8:143582652-143582674 TGGCCCGCAGAGCCAGGCAGTGG - Intronic
1049709338 8:144056632-144056654 TGCCCCGAAGTCCCCCGCACGGG + Exonic
1053323354 9:37120074-37120096 TGGCCCGCAGACCTGGGCAGCGG - Intergenic
1055348002 9:75356840-75356862 TGGACCCAAAACCCCAGCACCGG - Intergenic
1056391679 9:86146776-86146798 TGGACCCAAAACTCCGGCACCGG + Intergenic
1057706711 9:97399917-97399939 TGGCCTGAGGACCCCGGCCCTGG + Intergenic
1059077589 9:111210360-111210382 TGGTCCGAAGACCAAGGAACAGG + Intergenic
1188552436 X:31378471-31378493 TGGACCCAAAACTCCGGCACCGG + Intronic
1197470698 X:126863813-126863835 TGGACCCAAAACTCCGGCACCGG + Intergenic
1200659341 Y:5941864-5941886 TGGACCCAAAACTCCGGCACCGG + Intergenic