ID: 1015626995

View in Genome Browser
Species Human (GRCh38)
Location 6:135189628-135189650
Sequence CTGTAGCCTGTAAGTAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015626995 Original CRISPR CTGTAGCCTGTAAGTAATGA GGG Intronic
905962009 1:42050817-42050839 CTGTGGCCTGGAGGAAATGATGG - Intergenic
910712767 1:90198903-90198925 CTGCAGGCTGTAAGCAAAGAGGG + Intergenic
911408917 1:97477473-97477495 CAGTAGCCTCTAAGTATTCAAGG - Intronic
911787579 1:101969975-101969997 CTGTAGCCTGAAGGGCATGAGGG - Intronic
917777942 1:178358349-178358371 CTATAGACTTTAAGTAAAGAAGG + Intronic
917837735 1:178954125-178954147 CTGTGGGCTGGAAGCAATGACGG - Intergenic
918664341 1:187130993-187131015 TTGTAGCCTGTAAGAACTGGGGG - Intergenic
924412916 1:243825239-243825261 CTGTGGCCTGTCAGGGATGAGGG + Intronic
924444809 1:244119345-244119367 ATGGAGCCTGTAAGTGAGGAGGG + Intergenic
1063080753 10:2765061-2765083 GTGTAGCAAGTAAGAAATGATGG + Intergenic
1064340803 10:14483669-14483691 CTTTACCCTCCAAGTAATGAGGG + Intergenic
1064676215 10:17762978-17763000 CAGTAGCCTGGAAATAATGCTGG - Intronic
1065365903 10:24936739-24936761 TTGTGGCCTGGAAGTAAAGAAGG - Intronic
1068073588 10:52226000-52226022 CACTAGCATGTAAGTCATGAGGG + Intronic
1068723554 10:60274525-60274547 GTCTACCCTGTAATTAATGAAGG - Intronic
1069058244 10:63866849-63866871 CTGGGGCCTGGCAGTAATGATGG + Intergenic
1070885398 10:79892283-79892305 CTGTGGCCTGTCACTAATGGAGG - Intergenic
1076475870 10:130751098-130751120 CTGCAGCCTCCACGTAATGAGGG - Intergenic
1077831688 11:5879472-5879494 CTGTAGACTTTATGTAATAAGGG - Intronic
1079875579 11:25853152-25853174 CTGAAGCATGGAAGTAAGGAAGG + Intergenic
1081319192 11:41669272-41669294 CTGTAGCATTTCAGTACTGATGG - Intergenic
1083998979 11:66285730-66285752 CAGGAGCACGTAAGTAATGAAGG + Exonic
1089275077 11:117329326-117329348 CTCTATCCTGTAAATGATGAGGG - Intronic
1091082843 11:132688566-132688588 ATGCAGCCTGGAAATAATGATGG + Intronic
1092120380 12:6039460-6039482 CTTTGGCCTGAAAGTACTGATGG - Intronic
1093139390 12:15490068-15490090 CTTTAACCTATAAGTGATGAGGG + Intronic
1094396432 12:30011499-30011521 CTTTCGCCTGTATGTAATAAGGG + Intergenic
1094452381 12:30596405-30596427 CTGTATCTTGAGAGTAATGATGG + Intergenic
1097991747 12:65842407-65842429 CTGGTGGCTGTAAGTAATTAAGG - Intronic
1098172625 12:67762238-67762260 CTGTAGCCTGAGACTAAGGAGGG + Intergenic
1098987997 12:77032839-77032861 ATGTATCCTGTAAGCTATGATGG - Intronic
1100764376 12:97847224-97847246 CTATAGCATGTAACTAATGCTGG - Intergenic
1105838675 13:24233848-24233870 CTGTAGCCTGTCAGCAGTGCTGG - Intronic
1113343430 13:109448636-109448658 CTGTAGACTGACAGTAGTGATGG - Intergenic
1115729874 14:36257281-36257303 TTGTAGCCTGTCTGAAATGAAGG - Intergenic
1116402528 14:44525745-44525767 CTGTAGCCTGTGATTAAACAAGG - Intergenic
1118211338 14:63768666-63768688 CTGTAGCCTGTCCGTATTGTAGG + Intergenic
1119661659 14:76456576-76456598 CTGCAACCTGTCAGAAATGAAGG - Intronic
1121475318 14:94195477-94195499 CTGTGGCCAGTAATTAATGTTGG + Intronic
1124138968 15:27060708-27060730 CTGTAGGGTGTAAGGAAGGAGGG + Intronic
1126978891 15:54218634-54218656 CTATATCCTGTAAGCAATCAGGG + Intronic
1131030653 15:89183749-89183771 CTGCAGCCTGTCTGCAATGAAGG + Intronic
1131920340 15:97320213-97320235 CTGAAGGCTGGAAGTATTGAAGG - Intergenic
1132387995 15:101415371-101415393 CTGTTGCCATTAAGGAATGAGGG + Intronic
1133425803 16:5688352-5688374 CAGTAGCCTGTAAGTCAAAATGG - Intergenic
1138022699 16:53498956-53498978 CTGTAGCATGTAAGTGCTGGGGG - Intronic
1139934645 16:70560583-70560605 CAGGAGGCAGTAAGTAATGAAGG + Exonic
1140789525 16:78377922-78377944 TTTTGGCCTGTATGTAATGAAGG + Intronic
1140831537 16:78755963-78755985 CAGAGGCCTGTAAGAAATGATGG + Intronic
1141009529 16:80384574-80384596 CTGTAGCTTGGAAGGAAGGAAGG + Intergenic
1148283672 17:46369347-46369369 CTGTAGACTTTGAGTAAAGAAGG - Intergenic
1148305890 17:46587264-46587286 CTGTAGACTTTGAGTAAAGAAGG - Intergenic
1149734836 17:58983566-58983588 CTGTAACTTGTATTTAATGATGG + Exonic
1150887549 17:69105041-69105063 CTGTATCTTGTACTTAATGAAGG + Intronic
1151267590 17:72968650-72968672 CTGTAGCCTGTAGGTGCTGATGG - Intronic
1154021227 18:10665704-10665726 CTGCATCCTTCAAGTAATGAGGG - Intergenic
1167321006 19:48797120-48797142 CTGTAACCTGCCAGGAATGATGG + Intronic
925744235 2:7031123-7031145 CTGTAGCCTGTTAGGAACCAGGG - Intronic
926499181 2:13631892-13631914 CAGTAGTCAGTAAGTAATGAAGG + Intergenic
930235218 2:48882792-48882814 GTTTATCCTGTAAGTCATGAGGG - Intergenic
930363373 2:50409905-50409927 CTCTGTCCTGTAACTAATGAAGG - Intronic
930616193 2:53596929-53596951 TTGGAGCCTGTAAGTACTTAGGG - Intronic
933884325 2:86703943-86703965 CTGAAGCCTGTTAGCAATAATGG + Intronic
936641110 2:114313716-114313738 CTGCATCTTTTAAGTAATGATGG - Intergenic
938864008 2:135399471-135399493 CTGCACCCTGGAAGGAATGAGGG + Intronic
940040336 2:149353296-149353318 TTGTAGGATGTAAGAAATGATGG + Intronic
941708548 2:168686766-168686788 GTGTAGCCTTTAATTAATTACGG + Intronic
943052849 2:182937552-182937574 CTGTATCCTTCAAGCAATGAGGG + Intronic
946978119 2:225175744-225175766 CTGTCTCCTGTAAGTAGGGAAGG + Intergenic
947545822 2:231009459-231009481 CTGTGGGCTGTTAGTAGTGAAGG + Intronic
947553805 2:231069619-231069641 GTGTAGGCAGTAAGTCATGAGGG + Intronic
1170135629 20:13070623-13070645 CTTTATCCTGCAGGTAATGAGGG - Intronic
1171021711 20:21590277-21590299 CTGTAGCCAGCAGGTCATGAAGG - Intergenic
1172906914 20:38377262-38377284 CTGTAGCAGGCAAGAAATGAGGG - Intergenic
1174096988 20:48097440-48097462 CTGTAGCTTCCAAGGAATGACGG + Intergenic
1178023872 21:28442354-28442376 CTGTAGCCGGTAAGAAACCAAGG + Intergenic
1184414456 22:44344132-44344154 CTTTAGCCTGAAAGTAAATAGGG - Intergenic
949276155 3:2284204-2284226 CTGTAGACTGGAAGCAGTGAAGG + Intronic
950621798 3:14211956-14211978 CTGTAGCCTGAAAGGAATCCTGG + Intergenic
950738960 3:15034381-15034403 TTGAAGGCTGTAGGTAATGATGG + Intronic
951717963 3:25668913-25668935 CTGTACCCTGTAATTATTGCAGG - Intergenic
952645758 3:35656718-35656740 CTGTAGCCTGATAGTGATGGTGG + Intronic
952965516 3:38618638-38618660 CTGTAGCCTGAATGTACTGTGGG - Intronic
955710967 3:61778704-61778726 CTGTAGCCTTGAAGGAGTGAAGG + Intronic
956499386 3:69865715-69865737 CTCTAGCCTGTCAGCAAGGAGGG + Intronic
959669000 3:108953759-108953781 CTGTAGACTGTGAGTCAAGATGG - Exonic
962615747 3:137124906-137124928 CAGTAGCCTTTAAGTTATGGTGG + Intergenic
965253204 3:166369017-166369039 CTGTAGCCTGGAAGTACTGTGGG + Intergenic
965743510 3:171901343-171901365 CTGTATCCTGTAATCAATGAAGG + Intronic
965743515 3:171901376-171901398 CTGTATCCTGTAATCAATGAAGG + Intronic
965963000 3:174451198-174451220 GTGGATCCTGTAAGTACTGAGGG + Intronic
967457968 3:189711704-189711726 CTGTAGGCTGTCAGTCATTATGG - Intronic
976621826 4:87136219-87136241 CTGTAAACCATAAGTAATGAAGG + Exonic
979388335 4:120097182-120097204 CTGAAGCTTTTAAGAAATGAGGG + Intergenic
979520539 4:121661411-121661433 CTGTAGCCTTGTAGTATTGATGG + Intergenic
979570687 4:122220327-122220349 CTGTAGCATGGAACTACTGATGG + Exonic
980061308 4:128133141-128133163 CTGTAGCCTGTTAGGAACCACGG - Intronic
987338424 5:16917909-16917931 ATGTAGCCTGGAAGTTATCAAGG - Intronic
991111810 5:62908840-62908862 CACTTGTCTGTAAGTAATGAGGG - Intergenic
992907093 5:81357214-81357236 CTGTAGACTCTAAGTAATGTGGG - Intronic
995728715 5:115212536-115212558 CTGTGGCCTGTCACTAATGGAGG - Exonic
995787486 5:115845082-115845104 CTTTAGCATAAAAGTAATGATGG + Intronic
999494751 5:152085827-152085849 CTCTAGTTTGAAAGTAATGAAGG - Intergenic
1000427679 5:161111786-161111808 TTGTAGCATGAAAGTAATCAAGG + Intergenic
1000510198 5:162171917-162171939 CTTTAGGAAGTAAGTAATGAGGG + Intergenic
1004993608 6:21166307-21166329 CTTTATTCTGTAGGTAATGAGGG + Intronic
1006286927 6:33103924-33103946 CTGGAACCTGTAAGTCATGCTGG - Intergenic
1007928032 6:45665633-45665655 GAGTAGCCAGAAAGTAATGAGGG + Intergenic
1008086547 6:47251282-47251304 CTATAGCCTTTGAGTTATGATGG - Intronic
1008638381 6:53435497-53435519 CAGTAGCATGTACGTCATGAGGG + Intergenic
1008775019 6:55027665-55027687 CAGTTGGCTGTAAGTAATTACGG + Intergenic
1009808481 6:68633050-68633072 CAGTAGCCTGCAATTTATGAAGG + Intergenic
1015626995 6:135189628-135189650 CTGTAGCCTGTAAGTAATGAGGG + Intronic
1018399938 6:163412626-163412648 CTATGGTCTCTAAGTAATGAAGG - Intergenic
1020470741 7:8531809-8531831 TTGTAGGCTGCAAGTAATGGTGG - Intronic
1023620043 7:42061761-42061783 CTGTAGAGTGTATGTAGTGATGG + Intronic
1025021403 7:55483277-55483299 CTGGAGCCTGTTAGAAATGCAGG - Intronic
1027912175 7:84264812-84264834 CTGTCTCCTGTAAGTAATCCTGG + Intronic
1028423980 7:90665579-90665601 GAGTAGCTTTTAAGTAATGAGGG + Intronic
1029816644 7:103103536-103103558 CTGGAGGCTCTAAGTAATGCTGG + Exonic
1038100408 8:24367445-24367467 CTGTAGCCATGAAGTACTGAGGG - Intergenic
1044409175 8:91866342-91866364 CTCTAGTCTATAAGTCATGAAGG - Intergenic
1044949335 8:97419892-97419914 CTGAAGACTGTAAGGAAAGAGGG - Intergenic
1046924668 8:119773378-119773400 TTGTAGCCTTGAAGAAATGAGGG - Intronic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1056216807 9:84412801-84412823 CTGTAGCGTGAAAGCAATCATGG + Intergenic
1059721292 9:116962449-116962471 GTGTAGCCTCTAAGCCATGATGG + Intronic
1060138796 9:121185472-121185494 CTGTATCCTGATAGTGATGATGG - Intronic
1060408803 9:123386552-123386574 TTGTAGTTTTTAAGTAATGATGG + Intronic