ID: 1015627533

View in Genome Browser
Species Human (GRCh38)
Location 6:135195999-135196021
Sequence TTCTGTAAGTAGAATTGTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015627531_1015627533 13 Left 1015627531 6:135195963-135195985 CCTCTTAGAATTTGCAGAAACAC 0: 1
1: 0
2: 3
3: 14
4: 213
Right 1015627533 6:135195999-135196021 TTCTGTAAGTAGAATTGTGAAGG 0: 1
1: 0
2: 2
3: 13
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015627533 Original CRISPR TTCTGTAAGTAGAATTGTGA AGG Exonic
900956428 1:5888868-5888890 TCCCGGAAGTAGAATTCTGATGG - Intronic
902853806 1:19184357-19184379 TTGTGTAAGTAGAATTAGGTGGG - Intronic
902893201 1:19460122-19460144 TTCTATCTGTAAAATTGTGAAGG + Intronic
904391207 1:30187378-30187400 GTCTGTTAGCAGAATGGTGATGG + Intergenic
905264499 1:36741993-36742015 TGCTGTTAGTAGAAGTGGGATGG - Intergenic
905870125 1:41398805-41398827 TTCTGAAGTTAGAATTGTCAGGG + Intergenic
907356891 1:53882924-53882946 TTCCGTAAGTACACTTGTGGAGG - Intronic
907424893 1:54373358-54373380 CTCTGTAACTAGAATCATGAAGG - Intronic
911710246 1:101063412-101063434 TGCTGTAAGCATAATAGTGATGG + Intergenic
916415901 1:164591730-164591752 TTCTGTTAGCAGACTTGTGCAGG + Intronic
920734523 1:208518784-208518806 TTCTATAATTAGAATTCTCAAGG - Intergenic
921460723 1:215423431-215423453 TTTTGTGTGTAAAATTGTGATGG - Intergenic
922712079 1:227841898-227841920 TTCTGTAAGAAGCATGGTGCTGG + Intronic
923951446 1:238960064-238960086 TTTTGTAAGTAAAATACTGAGGG + Intergenic
1063270040 10:4498058-4498080 TTCTGTAAGTAAAATCGTCCTGG + Intergenic
1064324729 10:14339545-14339567 TTCTGTAAGGAGAATTCTGAAGG + Intronic
1065539505 10:26747598-26747620 TTCTGTAGGTAAAATTCTTAAGG - Exonic
1065681458 10:28237909-28237931 TTCAGGAAGTAGAAGTGTGGTGG - Intronic
1070002386 10:72389569-72389591 CAGTGTAAGTAGAATTGTGCAGG + Intronic
1070088078 10:73255856-73255878 TTTTGTAAGTAAAATTGTATTGG + Intronic
1070426182 10:76289926-76289948 TTCTGAGAGAAGAATTTTGAGGG + Intronic
1072213605 10:93269509-93269531 TTCTGGAAGTGGAATTATCAGGG + Intergenic
1072411869 10:95210267-95210289 TTTTGGAAGTAGAGTTGTCAGGG + Intronic
1076523282 10:131094346-131094368 CTCTGTAAGGAGAAGTGGGAGGG - Intronic
1079730290 11:23932375-23932397 TTCTGTAAATAAGATTCTGAAGG - Intergenic
1079982612 11:27167109-27167131 TTTTGTAAATCCAATTGTGATGG - Intergenic
1080756653 11:35206699-35206721 TCCTGTAAGGAGAAACGTGAAGG + Intronic
1080959696 11:37144546-37144568 TTCAGTAAGTAGATTTTTGTAGG + Intergenic
1081561630 11:44222460-44222482 TCCTGTCAGTAGAATTGTAAGGG + Intronic
1085299385 11:75449498-75449520 ACCTGTGAGTAGAACTGTGAAGG - Exonic
1085506167 11:77061111-77061133 TTCTGTAATTAAAACTGGGATGG - Intergenic
1085766340 11:79286353-79286375 TTCTATAAGTAGAAATAGGATGG + Intronic
1085798551 11:79566150-79566172 TTATGTAAATAAAATTGTGTTGG - Intergenic
1086486780 11:87312878-87312900 TTCTGGAAATAGAAAAGTGAAGG - Intronic
1089693413 11:120200686-120200708 TTCTGGAAATAGAATTCTCAGGG - Intergenic
1091866287 12:3839838-3839860 TGATGTTAGTAAAATTGTGATGG + Intronic
1092765174 12:11846622-11846644 TACTATAAATAGAATTGTTAAGG - Intronic
1093384515 12:18535562-18535584 TTCAATAAGGAGAATTATGATGG - Intronic
1095608148 12:44095437-44095459 TTCTGCAAATAGAAATTTGATGG + Intronic
1095769846 12:45941582-45941604 TTTTGGAAGTAGAATGGTGGTGG - Intronic
1095919836 12:47518028-47518050 TTCTGGAAGCAGAAACGTGAAGG + Intergenic
1098811753 12:75103298-75103320 TTTGTTAAGTAGAATTGTTAAGG + Intronic
1099295145 12:80821071-80821093 TTTTGTAAGTGGAACTGTAATGG - Intronic
1100278098 12:93090714-93090736 TTCTGCAGGTAGAATTCTGTGGG + Intergenic
1101799017 12:108004214-108004236 TTCTGCAAGTTGAAATGTGGGGG + Intergenic
1102971065 12:117167172-117167194 TATTGTAAGTAGAAATGTTATGG - Intronic
1103708049 12:122889986-122890008 TTCTCTAAGTAGGCTTTTGATGG - Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106524904 13:30531965-30531987 TTTGGGAAGTAGAATTATGAAGG - Intronic
1106778623 13:33033151-33033173 TTCGGAAATGAGAATTGTGAAGG - Intronic
1107131151 13:36897118-36897140 TTATGTAATTAGAACTGTGAAGG - Intronic
1108695723 13:52900777-52900799 TTCTCTAAGTAAAATAGGGATGG - Intergenic
1110048035 13:70856181-70856203 TTCAGTAAGTAGAAATGTGAAGG + Intergenic
1111444256 13:88324725-88324747 TTCTAAAAATAGAATTGTAATGG + Intergenic
1111541624 13:89675163-89675185 TTCTGCAAAGATAATTGTGAAGG + Intergenic
1112864829 13:103881756-103881778 TTGTGTAAGAAGTATTGAGATGG + Intergenic
1114672951 14:24422312-24422334 TTCTGGGAGCTGAATTGTGAGGG + Intergenic
1114837527 14:26221028-26221050 TTCTGGAAGTAGAATAGAAAGGG + Intergenic
1116350081 14:43850206-43850228 TTCTGTAGGTAACATTGTCATGG + Intergenic
1120580399 14:86240720-86240742 TCCTGGAATTAGAATTATGATGG + Intergenic
1120878407 14:89395254-89395276 ATCTGTAAGCAGAATTGTCCCGG - Intronic
1120957477 14:90095671-90095693 TTCTGTGACCAGAAGTGTGAGGG + Intronic
1124222199 15:27860734-27860756 TACTGTGAGTAGCATAGTGATGG + Intronic
1124449665 15:29775380-29775402 TTCTATTAGTGAAATTGTGAAGG + Intronic
1124492417 15:30166231-30166253 TTTTGTAAGTAAAATTTTGTTGG + Intergenic
1124751118 15:32372086-32372108 TTTTGTAAGTAAAATTTTGTTGG - Intergenic
1125030552 15:35071573-35071595 TATTTAAAGTAGAATTGTGACGG - Intergenic
1125084218 15:35711788-35711810 TTTTGTAAGAATCATTGTGAAGG + Intergenic
1125703638 15:41711324-41711346 AGCTGTAAGTAGAGTTGTTAAGG - Exonic
1125775620 15:42210032-42210054 AGCTGTAAGTAGAATTATCAGGG + Intergenic
1126392614 15:48176286-48176308 TTCCATAAGAAGATTTGTGATGG - Intronic
1126463440 15:48938291-48938313 TCCTGTAAGTTGCATTGTTAAGG - Intronic
1127379339 15:58417048-58417070 TTCTTAAAGTAGAATTGCTAAGG - Intronic
1130819992 15:87485039-87485061 TTTTGTAAGTAAAATTGTATTGG + Intergenic
1131972864 15:97909572-97909594 TTCTCTAAGTGGGATTGTGTTGG - Intergenic
1133834467 16:9354370-9354392 TTCTGTAACCAGAATTCTCATGG + Intergenic
1133882447 16:9795597-9795619 TTCTGTAACTACAATGGTGATGG + Intronic
1134163214 16:11909207-11909229 CTTTGAAAGTAGAATTATGATGG + Intronic
1134232612 16:12440310-12440332 TTCTGGAATTAGAGTGGTGATGG - Intronic
1136384814 16:29917283-29917305 TTTTGTAAATATGATTGTGAAGG - Intronic
1138204962 16:55117968-55117990 TTCTGTAACTAGAACCTTGAAGG - Intergenic
1138762910 16:59565317-59565339 ATCTATAATTAGAAATGTGAGGG - Intergenic
1140357291 16:74317318-74317340 CTGTGTAAGTATGATTGTGATGG + Intergenic
1140719135 16:77755079-77755101 TTCTGAAACTAGAATTTTCAGGG + Intergenic
1143316981 17:6040360-6040382 TTCTTTATGAAGATTTGTGAGGG + Intronic
1151116083 17:71736750-71736772 TTCTGTGATTAGAATTCTGAAGG + Intergenic
1152182659 17:78833667-78833689 ATCTCTAAGTAGAATTCTGGAGG - Intronic
1154389018 18:13920648-13920670 TTGTTTAAGTTGCATTGTGAGGG + Intergenic
1155257087 18:24008172-24008194 GTTTGTAAGTTGAATGGTGAGGG - Intronic
1156641114 18:39100051-39100073 TTCTGTCAGTTGAATTTTGGGGG + Intergenic
1158379106 18:56908690-56908712 TTCTGAAAACAGACTTGTGAGGG - Intronic
1159347456 18:67225478-67225500 TTCTGTAAGGAGAATTAAGTAGG + Intergenic
1159524082 18:69565991-69566013 GTTTGTAAGTAAAATTTTGATGG + Intronic
1159748101 18:72264412-72264434 TTCTGTCAGCAGAAGTGTTATGG + Intergenic
1161941022 19:7404157-7404179 ATCTGTAAGAAGAAATGTGAAGG + Intronic
1163292663 19:16390109-16390131 TTTTGTAAGTAGCATAGTGTTGG - Intronic
930325314 2:49909254-49909276 TACTGTAATCAGAAGTGTGAAGG + Intergenic
930925438 2:56812492-56812514 TTCAGTAAGGATAATTTTGAGGG + Intergenic
931201124 2:60098143-60098165 TTGTGTAAATAGTATTGTAATGG - Intergenic
932049946 2:68388436-68388458 TTCTGAAAGAAGAATTCAGAGGG + Exonic
932162107 2:69470065-69470087 TTCTGTAGGGAGCATTCTGATGG - Exonic
933283105 2:80354491-80354513 TTCTGGAGATAGAATTTTGAGGG + Intronic
933934597 2:87191936-87191958 TTCTGTCAGTTAAATTGAGATGG - Intergenic
935087999 2:99867283-99867305 TTCTTTAGGAAGAATTCTGATGG + Intronic
935155036 2:100477223-100477245 TCCTGGAAAGAGAATTGTGAGGG - Exonic
935967246 2:108492967-108492989 TTCTGTAAGTATAATGAAGAGGG - Intronic
936358546 2:111773960-111773982 TTCTGTCAGTTAAATTGAGATGG + Intronic
936706474 2:115080496-115080518 TTCTGTAAATAGAGTTTTGTCGG + Intronic
937371615 2:121301618-121301640 TACAGTAAGTATAATAGTGATGG + Intergenic
943516960 2:188900557-188900579 TTGTGTGAGTAGAATTGGGTTGG - Intergenic
945425997 2:209703032-209703054 GTCTGCAAGTATAATTGGGAAGG - Intronic
945827177 2:214736411-214736433 CTCTGTAAGTACCATTGGGAAGG - Intronic
946714003 2:222534207-222534229 TTGTGTAAGTTGAATAGTCAGGG - Intronic
947682054 2:232043580-232043602 TACTGAAAGTAGAATTCAGAAGG + Intronic
1168762505 20:358863-358885 TTCTGTAAGAAGACTTGTCCTGG - Intronic
1169353386 20:4888220-4888242 TTCTGTAAGTAAAGTTGTACTGG + Intronic
1169818435 20:9683156-9683178 TTGGGTAAATAGAAATGTGAGGG - Intronic
1170383273 20:15785579-15785601 TTCTGTAAGTAGATCTTTAAGGG + Intronic
1171163790 20:22953038-22953060 TTCTGTGGGGAAAATTGTGAAGG - Intergenic
1172105172 20:32512755-32512777 CTTTGTAAGTAGAATTTTTATGG + Intronic
1173462627 20:43255766-43255788 TTCTGAAATTAGAGTGGTGATGG + Intergenic
1174654235 20:52156959-52156981 TTTTGTAAGCAGAATTTAGAGGG + Intronic
1177467026 21:21497979-21498001 TGCTGTAAATAGTATTGTAAGGG + Intronic
1177914700 21:27074476-27074498 TTCTATTAATAGAAGTGTGATGG - Intergenic
1178164334 21:29955117-29955139 TTTTGTAAGTAAAGCTGTGAAGG + Intergenic
951267035 3:20579633-20579655 TTCTATATTTTGAATTGTGATGG - Intergenic
952256874 3:31703283-31703305 TTCTTTCAATAGAATTCTGAGGG - Intronic
952834023 3:37589119-37589141 ATCTGTAGGTAGAGTTGTGTAGG + Intronic
953336717 3:42099822-42099844 TTATGTGAGTAGAAATGAGAAGG + Intronic
953600122 3:44354829-44354851 ATCTGTAATTAGTATTGTGGCGG + Intronic
956760901 3:72443649-72443671 TTCTGCAGGTGGAATTGTTAAGG - Intronic
957147696 3:76445212-76445234 TTCTGAAAGTATAATTGTACAGG + Intronic
957522091 3:81330571-81330593 TTCTGGAAGTTGAATGATGATGG - Intergenic
957906237 3:86559956-86559978 TGCTGTAGGTATAAGTGTGAAGG + Intergenic
958129623 3:89401298-89401320 TCCTTTGAGTAGAATTGTCATGG - Intronic
959324296 3:104917228-104917250 TTTTTTAAGCAGAATTCTGAAGG + Intergenic
961768682 3:129232083-129232105 ATCTGGAAGTAGAATTGACATGG - Intergenic
963025542 3:140915227-140915249 TATTTTAAGTAGAATTTTGAAGG + Intergenic
963896108 3:150686690-150686712 TTCTATCTGTAAAATTGTGAAGG - Intronic
965730459 3:171766573-171766595 TTCCATAAATAAAATTGTGATGG + Intronic
965957854 3:174392498-174392520 CTTTGGAAGTAGAATTGTTAGGG + Intergenic
966728930 3:183134197-183134219 TTTTGGAAGTGGAATTGTTAGGG + Intronic
966815651 3:183887666-183887688 ATCTGTAAGAAGAAAAGTGATGG + Intergenic
967416200 3:189221551-189221573 TGCCGTAAGTGGAAGTGTGAAGG + Intronic
969059926 4:4426349-4426371 TTCTGTAAGCAGGAGTGGGAGGG + Intronic
969387761 4:6867203-6867225 TGCTGTAGGTAGAATGGTGGAGG + Intronic
970375895 4:15456775-15456797 TGCAGTCATTAGAATTGTGAGGG + Intergenic
971793139 4:31194991-31195013 TTCTCTAAGCAGACTTGTTAGGG - Intergenic
971930135 4:33070949-33070971 TTCTGCCAGTAGAATTTTGGGGG - Intergenic
972207480 4:36793934-36793956 TTCTGTAAGTAGCATAAAGATGG + Intergenic
972995485 4:44873651-44873673 TCCTGTATTTAGAAATGTGATGG - Intergenic
974074030 4:57152518-57152540 TTCTGGAAGTAAAATTGTTAGGG + Intergenic
974701369 4:65452503-65452525 TACTCTAAGTAAACTTGTGATGG + Intronic
974915814 4:68176962-68176984 CTCTGTGATTAGGATTGTGAAGG + Intergenic
975889490 4:79009994-79010016 TTCTTTTAGTTGAATTGTTAGGG + Intergenic
977772101 4:100871504-100871526 TTCTGCCAGTAGAAGTCTGAGGG - Intronic
979882596 4:125980639-125980661 TTTTGTTAGTAGAATTTTTATGG + Intergenic
980098294 4:128516233-128516255 TTCTATAAGTGAAATTTTGATGG + Intergenic
980294174 4:130888811-130888833 TTTTGTAGGTAAAGTTGTGATGG + Intergenic
980510169 4:133774596-133774618 TTGTCTAAGTAGAATTGACAAGG + Intergenic
980624295 4:135353038-135353060 CTCTGGAGGTAGAACTGTGATGG + Intergenic
981473104 4:145159573-145159595 TGATGTTAGTAAAATTGTGATGG - Exonic
982335260 4:154229406-154229428 TTTTGTAAGGGGAATTGGGATGG + Intergenic
983783801 4:171706662-171706684 TTCTGTAAGAAAAATGGAGAAGG - Intergenic
984396224 4:179203243-179203265 TCCAGTAAGTAGCATTGTTAAGG - Intergenic
986784259 5:11097479-11097501 CTCTGTAGGAAGAATTGTCAGGG + Intronic
987656927 5:20819160-20819182 TTCTGTAAATAGAGTTTTGTTGG + Intergenic
987715668 5:21566568-21566590 TTCTAGGAGTGGAATTGTGAGGG + Intergenic
988077494 5:26371596-26371618 TACTGTGAGTTGAATTTTGAGGG + Intergenic
988766626 5:34384788-34384810 TTCTGTAAATAGAGTTTTGTTGG - Intergenic
990153843 5:52851676-52851698 AAATGTATGTAGAATTGTGATGG - Intronic
991538508 5:67700362-67700384 TTCTGTAAGTATCATAGTGATGG + Intergenic
992241303 5:74772465-74772487 TTCTGTAAATAAAATTTTAATGG + Intronic
993435346 5:87886174-87886196 GTGCCTAAGTAGAATTGTGAAGG - Intergenic
995197083 5:109383137-109383159 TTCTTTTGGTAGAATTGTTAAGG - Intronic
996674804 5:126162035-126162057 TTCTGAAATTACAATTATGACGG - Intergenic
999296611 5:150463490-150463512 GTCTGTGAGTAGAGATGTGAAGG + Intergenic
1001434104 5:171686029-171686051 TGCTGTAAGTAGAAGTCTGGAGG - Intergenic
1002356447 5:178633202-178633224 TTCTATTTGTAAAATTGTGAAGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003634491 6:7820230-7820252 TTTTGTAAGTAGATTTTTAAAGG + Intronic
1003691810 6:8362271-8362293 GTCTGTAAGTGGAAGTGTGATGG - Intergenic
1004210391 6:13635595-13635617 TCCTGTTAGTAAAATTGTTAAGG + Intronic
1004445723 6:15695549-15695571 TAGTCAAAGTAGAATTGTGATGG - Intergenic
1004718499 6:18242862-18242884 TTCTATATGTGAAATTGTGAAGG + Intronic
1006313315 6:33276672-33276694 CTCTGTAAAGAGAAATGTGAGGG + Intergenic
1008192159 6:48473494-48473516 TTCTGAGAGTCCAATTGTGATGG + Intergenic
1008811540 6:55506897-55506919 TCCTATCAATAGAATTGTGAAGG + Intronic
1009001057 6:57715481-57715503 TTCTAGGAGTGGAATTGTGAGGG - Intergenic
1009282179 6:61766532-61766554 TTCTTTAAGATGCATTGTGAGGG + Intronic
1009397978 6:63223780-63223802 TTCTTTCAGTAGAATGCTGAAGG + Intergenic
1009436830 6:63628253-63628275 TTTTGTAAGTAGAACTGGCAAGG - Intergenic
1009472060 6:64039266-64039288 TTAGGTAAGTATTATTGTGATGG + Intronic
1009947383 6:70355715-70355737 TTCTGCAGGTAGAATTTTTATGG - Intergenic
1010002674 6:70963373-70963395 TTCTGTATGAAGATTGGTGAGGG + Intergenic
1010211764 6:73367825-73367847 TTCTGGAAGTAGAATTTTTGGGG - Intergenic
1010761350 6:79726796-79726818 TTCTTTAAGAAGACTTGTGTGGG - Intergenic
1010972089 6:82273868-82273890 TTGTGGAAGTAAAATTTTGAGGG + Intergenic
1011124170 6:83988339-83988361 GTCAGGAAGTAGAATTTTGATGG + Intergenic
1011442802 6:87405077-87405099 GTCTTAAAATAGAATTGTGATGG - Intergenic
1012177472 6:96106269-96106291 TTTTGTCAGAAGAATTGGGAGGG + Intronic
1014089591 6:117388559-117388581 TTCTGTAAATAAAGTTGTAATGG + Intronic
1014831056 6:126103447-126103469 TTCTGTAATTACAATTCTGTAGG + Intergenic
1015300832 6:131651350-131651372 TTCTGTATTTAGCATTGTTAAGG - Intronic
1015627533 6:135195999-135196021 TTCTGTAAGTAGAATTGTGAAGG + Exonic
1015679806 6:135793248-135793270 TTCTGAAACAAGAATTTTGAAGG + Intergenic
1016915499 6:149240441-149240463 ATCTGTCTGTTGAATTGTGAAGG - Intronic
1020714711 7:11657311-11657333 TTGTTTAGGTACAATTGTGAAGG + Intronic
1022773786 7:33503152-33503174 TTTTGTAAGTAAAATTGATAGGG - Intronic
1027126247 7:75558658-75558680 TTCTGTAAGTAGGACTTTCAAGG - Intronic
1027652128 7:80881016-80881038 TTTTATAAGAATAATTGTGATGG - Intronic
1028002824 7:85522206-85522228 TTCTGAGAGTAGAATTTTAAAGG - Intergenic
1030191703 7:106817099-106817121 TCCTGTAAGTAGAAATTTGTGGG + Intergenic
1030594068 7:111515312-111515334 TTCTGTAAGAAAAATTGTCTAGG - Intronic
1031607963 7:123792438-123792460 TTCTGTAAAATTAATTGTGAAGG + Intergenic
1032243302 7:130183852-130183874 TTATTTACCTAGAATTGTGAGGG - Intronic
1035333062 7:158108666-158108688 TTCTAGAAGTAGAAATCTGAAGG - Intronic
1037100930 8:15044829-15044851 TTCTATGAGTAGTTTTGTGAAGG + Intronic
1037269210 8:17107595-17107617 TTTTGTAAGTAAAATTGTATTGG + Intronic
1039678389 8:39699563-39699585 TTCTGTGTGTAGAATTTTGGGGG + Intronic
1040297688 8:46168499-46168521 CTCTTTATGTAGAACTGTGAAGG - Intergenic
1041391687 8:57352758-57352780 TTTTGGAAGTAGATGTGTGATGG - Intergenic
1041785379 8:61627060-61627082 TTATGTAAGTGGAATTGTTTGGG + Intronic
1043317817 8:78943068-78943090 TCCTGTAAGTAGAACAGTAAAGG + Intergenic
1043685795 8:83084808-83084830 TCCTGTTGGGAGAATTGTGAAGG - Intergenic
1044245657 8:89941852-89941874 TTATGAAAGTAGAGTTGTTAAGG - Intronic
1044298326 8:90554396-90554418 TTCTGGAAGAAGAATTGTTCAGG - Intergenic
1044458324 8:92415221-92415243 TTCTGTAAATACAATTTTGTGGG - Intergenic
1044696575 8:94928942-94928964 TTCTGTCAGTAGAATTGCTTTGG + Exonic
1045182033 8:99794631-99794653 TTCTGCTGGTAGAATTTTGAAGG + Intronic
1046592676 8:116225008-116225030 TTCTGAAAGTAGAAATGTTTTGG - Intergenic
1046977440 8:120297250-120297272 CTCTTTAAGTAGAAATGAGAGGG + Intronic
1047217068 8:122884812-122884834 GTTCTTAAGTAGAATTGTGAAGG - Intronic
1050905501 9:10999367-10999389 CCCTGTAAGTTTAATTGTGAAGG + Intergenic
1051135031 9:13910524-13910546 TTCTGTAAGGAATATTATGACGG + Intergenic
1051751170 9:20342509-20342531 TTCTGAAAATAGAGTTATGATGG - Exonic
1055084241 9:72298065-72298087 TTCTGTCATTAAAATTGTGAAGG - Intergenic
1055309392 9:74963080-74963102 TTCTCTAGGAAGAAGTGTGATGG + Intergenic
1056178329 9:84057509-84057531 TTATATAAGTAGAATTCTGGAGG + Intergenic
1058735943 9:107894272-107894294 TTCTATCTGTATAATTGTGAAGG + Intergenic
1058880883 9:109285211-109285233 TTACGTAAGTAGAGCTGTGATGG - Intronic
1059918622 9:119132932-119132954 TTGTGAAGGTAGAATTTTGATGG - Intergenic
1061775985 9:132964607-132964629 TTGTGTGTGTAGAATTGTGACGG - Intronic
1061956493 9:133964788-133964810 TTCTGTACCTAGATTTTTGAGGG - Intronic
1186006607 X:5078956-5078978 TACTGTAAGTATATGTGTGACGG - Intergenic
1186284695 X:8031054-8031076 TTCTGTAAGTAGAAAAGCCATGG + Intergenic
1188489209 X:30719741-30719763 GTCTGTAAGTTGTATAGTGAAGG + Intronic
1188534858 X:31185292-31185314 TTCTGAAAGTAGAATGGAGAGGG - Intronic
1189155298 X:38750600-38750622 TTCTCTAAACAGACTTGTGAAGG + Intergenic
1189774226 X:44455744-44455766 TTCTGTAAGTGGTATTGAAAAGG - Intergenic
1190396825 X:49993580-49993602 TTGTGTATCTAGCATTGTGAAGG + Intronic
1191614954 X:63160611-63160633 TTTTGTAAATAAAATTGTGTTGG - Intergenic
1191621342 X:63218312-63218334 TTTTGTAAATAAAATTGTGTTGG + Intergenic
1193515771 X:82461038-82461060 TTCTGTAAGTATTAATGTGAGGG + Intergenic
1194948964 X:100102124-100102146 TTCTGGGAGTAGAATTGAGATGG - Intergenic
1196504546 X:116425803-116425825 TTCAGTTTGTTGAATTGTGATGG - Intergenic
1196514680 X:116556053-116556075 TTCTGTACATAAAACTGTGATGG - Intergenic
1197641383 X:128971947-128971969 TTCTGTGTGTAGAAATGTTATGG + Intergenic
1197830103 X:130632486-130632508 TTCTGTTATTATAAATGTGAAGG + Intronic
1199289057 X:146085929-146085951 TTTTGTAAATAAAATTGTGTTGG - Intergenic
1199353624 X:146834484-146834506 TTCTTTAATAAAAATTGTGAAGG + Intergenic
1199467781 X:148158890-148158912 TTCTGTAAGCAGCAGTGGGAAGG - Intergenic