ID: 1015628290

View in Genome Browser
Species Human (GRCh38)
Location 6:135204677-135204699
Sequence AAACAATTGCTGTCAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 211}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015628290_1015628298 29 Left 1015628290 6:135204677-135204699 CCTCTCTCTGACAGCAATTGTTT 0: 1
1: 0
2: 1
3: 19
4: 211
Right 1015628298 6:135204729-135204751 GACAGGGAGTCAGTATTTATGGG 0: 1
1: 0
2: 0
3: 30
4: 181
1015628290_1015628297 28 Left 1015628290 6:135204677-135204699 CCTCTCTCTGACAGCAATTGTTT 0: 1
1: 0
2: 1
3: 19
4: 211
Right 1015628297 6:135204728-135204750 AGACAGGGAGTCAGTATTTATGG No data
1015628290_1015628299 30 Left 1015628290 6:135204677-135204699 CCTCTCTCTGACAGCAATTGTTT 0: 1
1: 0
2: 1
3: 19
4: 211
Right 1015628299 6:135204730-135204752 ACAGGGAGTCAGTATTTATGGGG 0: 1
1: 0
2: 0
3: 11
4: 182
1015628290_1015628294 -1 Left 1015628290 6:135204677-135204699 CCTCTCTCTGACAGCAATTGTTT 0: 1
1: 0
2: 1
3: 19
4: 211
Right 1015628294 6:135204699-135204721 TTGGTAAAATGGCTGTGGACTGG No data
1015628290_1015628296 13 Left 1015628290 6:135204677-135204699 CCTCTCTCTGACAGCAATTGTTT 0: 1
1: 0
2: 1
3: 19
4: 211
Right 1015628296 6:135204713-135204735 GTGGACTGGAATGTGAGACAGGG No data
1015628290_1015628295 12 Left 1015628290 6:135204677-135204699 CCTCTCTCTGACAGCAATTGTTT 0: 1
1: 0
2: 1
3: 19
4: 211
Right 1015628295 6:135204712-135204734 TGTGGACTGGAATGTGAGACAGG 0: 1
1: 0
2: 2
3: 18
4: 268
1015628290_1015628293 -6 Left 1015628290 6:135204677-135204699 CCTCTCTCTGACAGCAATTGTTT 0: 1
1: 0
2: 1
3: 19
4: 211
Right 1015628293 6:135204694-135204716 TTGTTTTGGTAAAATGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015628290 Original CRISPR AAACAATTGCTGTCAGAGAG AGG (reversed) Intronic
900807243 1:4775585-4775607 AACCAGCTGCAGTCAGAGAGGGG + Intronic
901792404 1:11661311-11661333 AAACAACTGCTGTCAGAAAAGGG + Exonic
902928706 1:19715415-19715437 AAACAATTGTTTTTAGAGACTGG + Intronic
906734764 1:48115012-48115034 ATGCATCTGCTGTCAGAGAGTGG - Intergenic
907898359 1:58714626-58714648 AGACAAATGCTGTGTGAGAGAGG + Intergenic
910011832 1:82473225-82473247 AAACAATGGATTTCAGAGATGGG + Intergenic
911672722 1:100625179-100625201 AAACAATTGCTGTGTGGTAGCGG - Intergenic
913503526 1:119494488-119494510 GACCAATGGCTGTCAGAGTGAGG + Intergenic
917563721 1:176188248-176188270 AAAGAATTCCTGTCAGAAATAGG + Intronic
920419980 1:205826467-205826489 AAAGAAATGCTGGCAGACAGCGG + Intergenic
921175372 1:212588687-212588709 AAGCAATTGCCTTCAGGGAGTGG - Intronic
922993951 1:229941246-229941268 CAACAATAGCGGCCAGAGAGGGG - Intergenic
1063100464 10:2945578-2945600 AGACAATTGCTGCCAGAGAGGGG - Intergenic
1063703154 10:8405182-8405204 AAACAATTGCTTTGAGAGGCGGG - Intergenic
1064859518 10:19812653-19812675 CTACAATTGCTGTCAGATAAAGG - Intergenic
1066416336 10:35224592-35224614 ATAAAGTTGCTGCCAGAGAGCGG - Intergenic
1067950752 10:50736067-50736089 TAATAATTACTGTCAGAGAAGGG + Intergenic
1070057451 10:72949254-72949276 GAACTATTGCTGTCCGAGATAGG - Intronic
1070495416 10:77016996-77017018 AAGCAAATGCTGTCAGTTAGGGG - Intronic
1070886098 10:79901274-79901296 TAATAATTACTGTCAGAGAAGGG + Intergenic
1073219683 10:101860406-101860428 AAACAATTCTTGTCAGATACTGG + Intronic
1073228214 10:101942960-101942982 AAACAATGGTTGTCAGACATTGG + Intronic
1074767703 10:116712292-116712314 AAACAATTTTTGCCAGAAAGAGG + Intronic
1076631524 10:131854955-131854977 CAACAAGTGATGTCAGAGAGAGG - Intergenic
1078860581 11:15242956-15242978 AGACCAGTGCTGTAAGAGAGTGG - Intronic
1079026179 11:16949781-16949803 TAACAAATGCTGTCAGAGCATGG + Intronic
1080258233 11:30317272-30317294 GAACAGTTGTGGTCAGAGAGTGG - Intergenic
1081138919 11:39473818-39473840 AAGCAATGGCTGTAAGAGACAGG - Intergenic
1084325608 11:68398142-68398164 AAACACGTGCTGTCAGAGGGTGG + Intronic
1086444888 11:86861434-86861456 ATACAAACGCTGTCACAGAGAGG - Intronic
1091269089 11:134293087-134293109 AGACAAGTGCTGTCAGGGAAGGG - Intronic
1091878412 12:3956738-3956760 AAACAAGTGCCGTCAGTGAATGG - Intergenic
1092601087 12:10065622-10065644 ACACAATTTCTTTCAGACAGAGG - Exonic
1092728226 12:11504992-11505014 AAACACTTGCTGACAGAGGCTGG - Intergenic
1092735893 12:11582445-11582467 AAACATTTTCTTTTAGAGAGGGG - Intergenic
1093191073 12:16076061-16076083 TTACAATATCTGTCAGAGAGAGG - Intergenic
1094145082 12:27220308-27220330 AAGCCCTTGCTGTCAGGGAGGGG + Intergenic
1094306930 12:29030680-29030702 AAACAATTGCTGTAAAGCAGTGG - Intergenic
1094773608 12:33695263-33695285 AAACAATTGAACTCAGAGATAGG - Intergenic
1098420393 12:70290562-70290584 AAACAATTGATTTCAGACACAGG - Intronic
1098599100 12:72308299-72308321 AGACAATTGATATCTGAGAGAGG + Intronic
1098647849 12:72927407-72927429 AAATTATTGATGTAAGAGAGAGG + Intergenic
1098965329 12:76782195-76782217 AAACAATTTCTCTGAGAGATTGG + Intronic
1100239559 12:92697738-92697760 GAAAGATTGCTGTCAGAAAGAGG - Intergenic
1100263647 12:92955491-92955513 AAATAATTTCTGGCAGAGCGTGG + Intergenic
1100749582 12:97682460-97682482 AAACAACTGCTTTCAGACATTGG + Intergenic
1103129427 12:118454090-118454112 GAACAATTCCTGCCACAGAGTGG - Intergenic
1104410902 12:128556837-128556859 ATGCAGTTGCTGTCAGATAGTGG - Intronic
1107045180 13:35985947-35985969 AAACAATCGTAATCAGAGAGTGG + Intronic
1108420058 13:50239769-50239791 AAAAAAGTGCTGACAGGGAGTGG - Intronic
1108520525 13:51243395-51243417 AAACAAATGCCTTCAGAAAGGGG - Intronic
1108621225 13:52185812-52185834 ATACAATTTCTTTCAGAGATAGG + Intergenic
1109870566 13:68327323-68327345 AAAAAAGTGGTGTCAGAGATAGG - Intergenic
1112423196 13:99272490-99272512 AAACTCGTGCTGTCATAGAGTGG + Intronic
1113958716 13:114113510-114113532 AAACAGTTGCCATCAGAGACTGG + Intronic
1115055544 14:29121742-29121764 AAAAAAGTGGTGTCAGAGATAGG + Intergenic
1115511129 14:34139056-34139078 AAACAATACATGGCAGAGAGGGG + Intronic
1120720422 14:87884537-87884559 AAATAATTGCACTGAGAGAGGGG + Intronic
1124030932 15:26011106-26011128 AAACAATTCCTGACATATAGTGG - Intergenic
1125179265 15:36862790-36862812 TAACAATAACTGTCAGGGAGAGG + Intergenic
1125517096 15:40327552-40327574 ACACAATGGCTTTCTGAGAGAGG + Intergenic
1125616363 15:41017320-41017342 GAACAATTGCTGTCATTAAGAGG + Intronic
1126778779 15:52120629-52120651 AAAAAATGGCTGTGGGAGAGAGG + Exonic
1127282669 15:57505102-57505124 AAACAATTGCTCTAAGAGGACGG + Intronic
1127345514 15:58093716-58093738 AAACAATTGCTGTCCAAATGGGG + Intronic
1127721568 15:61706406-61706428 AAACAATTGCTCTCAAATACTGG + Intergenic
1129602680 15:77009484-77009506 AAAAAATTGAGGCCAGAGAGTGG + Intronic
1131832683 15:96363858-96363880 AATGAAGTGCTGGCAGAGAGAGG + Intergenic
1131977354 15:97960383-97960405 AAACAGTATCTGTCAGGGAGGGG - Intergenic
1133440996 16:5820818-5820840 AAGAAATTGCTGTCAAAGAGAGG - Intergenic
1134362899 16:13549188-13549210 AAATAATTGTTGCCAGAGACTGG + Intergenic
1134426746 16:14156146-14156168 AAACAATTGCTTTCACACATTGG - Intronic
1135906432 16:26516281-26516303 TAACAAATGCTGCCAGAGATTGG + Intergenic
1136571468 16:31099917-31099939 ATACAATTGCAGTCAGATGGTGG + Intergenic
1137810321 16:51346507-51346529 ACACAATGGTTGTCAGGGAGGGG - Intergenic
1139113775 16:63924251-63924273 ACACAATTGCAGTTAGACAGGGG + Intergenic
1139556691 16:67716418-67716440 AAACACTTGTTTTCAGAGAAAGG - Intronic
1140629710 16:76836607-76836629 AAACAAATGCACTCAGAGGGAGG - Intergenic
1143751061 17:9028215-9028237 AAACTATTGTTGACAAAGAGAGG + Intronic
1146285446 17:31571433-31571455 AAAGAATTTCTGGCAGAGAGAGG + Intronic
1147233358 17:39036281-39036303 GAACAATTGGTGTTAGAAAGGGG - Intergenic
1147305685 17:39562562-39562584 AAAAACTTGCTGAGAGAGAGAGG - Intronic
1149436605 17:56638846-56638868 AGAGAAAAGCTGTCAGAGAGAGG - Intergenic
1152264865 17:79288327-79288349 AAATACTTGCCATCAGAGAGCGG + Intronic
1155644702 18:28063523-28063545 ACACAATGGCTGACAGAGATGGG - Intronic
1155734371 18:29202476-29202498 AAATAATAGCTGTCAATGAGAGG - Intergenic
1156824523 18:41414452-41414474 AAACAAAAGCTGTAAGAAAGAGG - Intergenic
1158644651 18:59234956-59234978 ATATAATTAGTGTCAGAGAGTGG - Intergenic
1158799084 18:60884831-60884853 AAACACTTGCTGTGAAAGAAGGG - Intergenic
1159509518 18:69378376-69378398 AAACATTTGTTTTCAAAGAGTGG - Intergenic
1159577273 18:70194995-70195017 AAGCATTTACAGTCAGAGAGAGG + Intronic
1162623712 19:11865735-11865757 AAAAAATTGCTGTCTGGGTGTGG + Intronic
1162878010 19:13635365-13635387 AAACAGTTTCTGGCACAGAGTGG + Intergenic
1165010225 19:32840642-32840664 AAACAACTGCTGGGAGAGAAAGG - Intronic
925485634 2:4326487-4326509 AAACAAGTGCGGTCAGATATGGG + Intergenic
925601432 2:5612117-5612139 CAACAATTGCTGCTAGAAAGTGG - Intergenic
926087893 2:10031695-10031717 AAACAAGAGCTGGCAGGGAGGGG - Intergenic
926737439 2:16084153-16084175 AAACAAATGCTGTCTGAGTCAGG + Intergenic
928011963 2:27617515-27617537 AAAGAATTTGTGTCAGAGAGTGG + Exonic
929254335 2:39793024-39793046 AAACAGTGCCTGTCATAGAGTGG - Intergenic
930817375 2:55612228-55612250 AAAAAATTGTTTTCAGAGATGGG - Intronic
935128500 2:100244080-100244102 ACACAGTTACAGTCAGAGAGTGG + Intergenic
935540008 2:104337832-104337854 AAATAATTGTGGCCAGAGAGTGG + Intergenic
936089274 2:109490536-109490558 ATGCCCTTGCTGTCAGAGAGAGG - Intronic
936633211 2:114227027-114227049 AAACAATTGCTGTCAGGGCTGGG - Intergenic
936725199 2:115305730-115305752 AAAAAAATGTTGTTAGAGAGAGG - Intronic
937657623 2:124394501-124394523 AAACAATTTCTGACAGAGAATGG + Intronic
938078049 2:128351784-128351806 CAGCAAGTGCTGTGAGAGAGAGG - Intergenic
939669651 2:144994484-144994506 AAATGATTGCTTTCAGAAAGGGG - Intergenic
940700357 2:157033441-157033463 AAACAATTGTTTTCAGAGACTGG + Intergenic
941595497 2:167471872-167471894 ATACAATGGCTCTCAGTGAGAGG + Intergenic
942715992 2:178892706-178892728 TAAGAATTGCTGGCAAAGAGTGG - Intronic
943096737 2:183438322-183438344 CTACAATTGCTGTCAGCCAGGGG - Intergenic
944111198 2:196132548-196132570 AAAGAACAGCTGTCAGAGAGGGG + Intergenic
944199294 2:197088892-197088914 AAGCAATTGTAGTCAGAAAGAGG + Intronic
945046527 2:205786903-205786925 AAACAAATGGTTTCAGGGAGTGG + Intronic
945680232 2:212904910-212904932 AAACAATTGATGACATAGACAGG + Intergenic
947007933 2:225533884-225533906 AAACATTTGCTATCAGATAAAGG + Intronic
948367716 2:237469166-237469188 AAACAAATGGTGTTGGAGAGGGG - Intergenic
948876793 2:240833741-240833763 AAACAATGGCTGTCAGGGCATGG + Intergenic
1177036152 21:16045616-16045638 AAATAATTACTGTGGGAGAGGGG - Intergenic
1177755599 21:25343567-25343589 AGACAAAAGCTGTGAGAGAGAGG + Intergenic
1178542711 21:33468077-33468099 AAAAAAGTGCGGACAGAGAGTGG + Intronic
1179612023 21:42558418-42558440 CAACAATGGTTGTCAGCGAGTGG - Intronic
1180725044 22:17940673-17940695 AAGCAATGGCAGCCAGAGAGAGG + Intronic
1182577212 22:31281028-31281050 AAACAATTGCTGAAGGGGAGAGG + Intergenic
1183034121 22:35127866-35127888 AAACAAATGCTTTGAGAGAAAGG + Intergenic
949131878 3:513284-513306 AAAAAATTACAGTGAGAGAGGGG - Intergenic
950240314 3:11363974-11363996 AAATACTTCCTGTCAGAGAGTGG - Intronic
951892662 3:27581595-27581617 GAACTGTTGCTGTCAAAGAGAGG - Intergenic
954239886 3:49285251-49285273 AAACAATTGTTTTCAGACATTGG + Intronic
955557303 3:60151714-60151736 AAACAATTGCAGGCAGAGGTAGG - Intronic
957163108 3:76635614-76635636 AGACAAATGCTGACATAGAGGGG - Intronic
957820548 3:85368452-85368474 AAGCAGTTGGTATCAGAGAGAGG + Intronic
957922258 3:86760734-86760756 CAACAAATGCTGGCAGAGAAAGG - Intergenic
958135035 3:89477780-89477802 AAACAATGGCTGCCAGTTAGTGG - Intronic
959396046 3:105839462-105839484 AAAGAACTGCTGGCAGAGATAGG + Intronic
959570520 3:107878209-107878231 ACACACTTGCTGTCAGACAATGG - Intergenic
960662265 3:120073461-120073483 AAACAGTGGCTGTGAGAGATGGG - Intronic
960742015 3:120844821-120844843 CAACACTTGCTGTAAGATAGTGG - Intergenic
960857213 3:122114399-122114421 AAACAACTGTTTTCAGAGATCGG + Intronic
961605742 3:128094269-128094291 ACACAATGGCCATCAGAGAGTGG + Intronic
961928465 3:130508603-130508625 AAACAATTCTTGTCAGATAAAGG + Intergenic
963051948 3:141150259-141150281 AAACAGATGATGTCAGAGGGCGG + Intergenic
966028572 3:175316991-175317013 AAACCATTGCAGGCAGACAGTGG + Intronic
966496483 3:180587148-180587170 AAACAACTGCTTTCAGATATCGG - Intergenic
967289561 3:187905675-187905697 AAATAAGTGCTGTGAGAGATTGG - Intergenic
967535653 3:190599536-190599558 AAACAATTGCAGAGAAAGAGAGG - Intronic
971881901 4:32386043-32386065 GAACAATTGCTGGCACAGAGTGG - Intergenic
973004369 4:44990154-44990176 AACCCATTGCTGTCCTAGAGAGG + Intergenic
973159623 4:46999655-46999677 AAACAATTTCTGTCAGTCACTGG - Intronic
974542567 4:63257013-63257035 AAACACTTGCAATCAGAGAGGGG - Intergenic
976042308 4:80901713-80901735 AACCAATTGCTGGCAGTGATTGG - Intronic
977777904 4:100943832-100943854 AAGCAAATGCAGTCACAGAGAGG - Intergenic
978858380 4:113419415-113419437 AAAAAGTTATTGTCAGAGAGGGG - Intergenic
979522035 4:121678642-121678664 AAGCAAATGCTTTCAGTGAGTGG + Intronic
979694758 4:123600326-123600348 AAGGAATTTCTGTCAGAGAATGG - Intergenic
980505969 4:133721763-133721785 AAACAAGTGCTATCATACAGTGG - Intergenic
981050848 4:140308079-140308101 AGATCATTGCTTTCAGAGAGTGG + Intronic
981623842 4:146734778-146734800 AAACAATTGGTGGCAGTGATGGG + Intronic
982819534 4:159928448-159928470 CAGCAATTCCTGTCAGAGATTGG - Intergenic
983556233 4:169061590-169061612 AAACAAAAGCTGTCAGAGTGGGG + Intergenic
986041748 5:4000397-4000419 AAAACATTGTGGTCAGAGAGTGG + Intergenic
986653768 5:9990372-9990394 AAATATTTGCTCTCAGATAGTGG + Intergenic
987477555 5:18410103-18410125 AAACAATAGCAGTAAGAGAGAGG + Intergenic
991154687 5:63418124-63418146 AAATAATTGCTGTCAAAGGCTGG + Intergenic
991283604 5:64943874-64943896 AAACACTGGCTGGCAAAGAGTGG + Intronic
993571569 5:89546350-89546372 AAACACATGCTGTTAGTGAGTGG + Intergenic
998110452 5:139498173-139498195 AAAAAATTTCTTTTAGAGAGGGG + Intergenic
998621424 5:143798389-143798411 AAAAAATTGCTGGCAGATAAAGG - Intergenic
999611360 5:153373342-153373364 ATGCCATTGCTTTCAGAGAGGGG - Intergenic
1001960196 5:175875412-175875434 AAACAATTAATGTCAGTGAGTGG - Intronic
1002991486 6:2243193-2243215 AAAAAATTCCAGTCAGGGAGTGG + Intronic
1003445649 6:6181344-6181366 AACCAATTGCAGGCATAGAGCGG + Intronic
1009144601 6:59657201-59657223 TAACATTTCCTTTCAGAGAGCGG + Intergenic
1010129866 6:72478885-72478907 AAACAACTGCTTTAAGAGAAGGG + Intergenic
1010392217 6:75350486-75350508 AAACAACTTCTATGAGAGAGGGG + Intronic
1011354119 6:86456057-86456079 AAACAATTGCTGTGACACAATGG + Intergenic
1014053696 6:116988256-116988278 AAACAATTGTTTTCAGACACTGG - Intergenic
1014520030 6:122431229-122431251 GAACTATTGCTGTCACTGAGGGG - Intronic
1015301882 6:131662122-131662144 CAACAAATGATGTCAGAAAGTGG - Intronic
1015628290 6:135204677-135204699 AAACAATTGCTGTCAGAGAGAGG - Intronic
1016298780 6:142606264-142606286 AAACAATTGTTCTCAGAGCTGGG - Intergenic
1016583756 6:145660509-145660531 AAACATTTGCTGGCTGAGTGCGG + Intronic
1018465618 6:164041958-164041980 AAACCATTGTTGTAATAGAGTGG + Intergenic
1018947087 6:168355619-168355641 AGACAATTGATGTCAGAGATAGG + Intergenic
1021478151 7:21086151-21086173 AGACAATGGCTTTCAGACAGGGG + Intergenic
1021543698 7:21789568-21789590 AAACATTTGCAGTCTGATAGTGG + Intronic
1021806837 7:24365947-24365969 AAACAATGGCTTTCAGACATTGG - Intergenic
1022397345 7:30001110-30001132 AAACAATTGTTGTCAGACATTGG - Intergenic
1022663184 7:32385670-32385692 GAACAATGTCTGGCAGAGAGTGG + Intergenic
1023242968 7:38168573-38168595 CAACCATCACTGTCAGAGAGTGG + Intergenic
1023690463 7:42780609-42780631 TAACAATGGCAGTGAGAGAGGGG - Intergenic
1026408347 7:70092339-70092361 AAACAAATGCTTTCAGAAGGAGG - Intronic
1028620061 7:92815494-92815516 AAACAACTGCTTTCAGATATTGG + Intronic
1028971538 7:96864350-96864372 ACACAATGGCTGTGGGAGAGAGG - Intergenic
1029097471 7:98100153-98100175 TAACAAATGCTGTGAGACAGTGG - Intergenic
1029122640 7:98279046-98279068 AAACAATTGTTGGAAGAGAAGGG + Intronic
1032505154 7:132428750-132428772 AAACAATTGCAGACAGGGAATGG - Intronic
1033269839 7:139920738-139920760 AAACAATGGTTTTCAGACAGTGG - Intronic
1036004139 8:4642803-4642825 AAACATTTGCTCTCAGACAGAGG - Intronic
1036576128 8:10029307-10029329 AGACACCTGCTGTCAGGGAGAGG + Intergenic
1040889264 8:52298859-52298881 TAACAATGGATGCCAGAGAGGGG - Intronic
1043245238 8:77991034-77991056 AAAAAATTCCTGACAGATAGTGG - Intergenic
1045280141 8:100742913-100742935 AAAGAAATGGTGTAAGAGAGAGG + Intergenic
1045663688 8:104464737-104464759 AAACATTGGCTGTCACTGAGAGG + Intronic
1046863665 8:119122441-119122463 AAACAACTGCTCTGACAGAGAGG + Intergenic
1047048738 8:121084938-121084960 AAAAAACTCCTGTAAGAGAGTGG + Intergenic
1050192900 9:3047261-3047283 AAACAATAGCTGTCACACAATGG + Intergenic
1050221722 9:3398771-3398793 AAACAGTTGATGTCAAAGTGTGG - Intronic
1050811911 9:9758978-9759000 AAAGGAATGCTGTCAGAGAATGG + Intronic
1053677188 9:40444320-40444342 AATATAATGCTGTCAGAGAGTGG + Intergenic
1053926946 9:43070429-43070451 AATATAATGCTGTCAGAGAGTGG + Intergenic
1054286531 9:63180595-63180617 AATATAATGCTGTCAGAGAGTGG - Intergenic
1054290261 9:63279847-63279869 AATATAATGCTGTCAGAGAGTGG + Intergenic
1054388287 9:64584385-64584407 AATATAATGCTGTCAGAGAGTGG + Intergenic
1054507434 9:65931975-65931997 AATATAATGCTGTCAGAGAGTGG - Intergenic
1055745236 9:79437082-79437104 AAAAAATTACTGTAAGTGAGAGG + Intergenic
1056508510 9:87280567-87280589 AAAAAATTCCTCCCAGAGAGTGG - Intergenic
1056631082 9:88293608-88293630 ATACATTTGATGTCAGAGTGTGG - Intergenic
1187827523 X:23346791-23346813 TGTCAAGTGCTGTCAGAGAGAGG + Intronic
1188954773 X:36421010-36421032 AACCAACTGCTGTGAGACAGAGG - Intergenic
1189234670 X:39477935-39477957 AAACATTTGCTGACAGGAAGAGG - Intergenic
1190589856 X:51988827-51988849 AAACAATTGGTGTCAAAGGTGGG + Intergenic
1190798210 X:53763628-53763650 AAACAATTGCTCTTACAGAAAGG + Intergenic
1191129839 X:56995716-56995738 AAACCAATGCAGTGAGAGAGAGG - Intergenic
1195566803 X:106348186-106348208 AAACAATTGGTGTCACAAACAGG - Intergenic
1196733759 X:118966577-118966599 AAACAATTGCTGGCCGGGCGCGG - Intergenic
1197238986 X:124103244-124103266 AAAAAATTGGTGGCAGAGGGTGG - Intronic
1198663270 X:138994882-138994904 TAACAACTGCATTCAGAGAGGGG + Intronic
1198892019 X:141407553-141407575 AAAAAATTGTAGTCAGAGATGGG - Intergenic
1200422239 Y:2984261-2984283 AAATAATTGCTGGCTGGGAGTGG + Intergenic