ID: 1015629299

View in Genome Browser
Species Human (GRCh38)
Location 6:135215446-135215468
Sequence GCGCCATACTCAAGGTTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 34}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015629299_1015629305 20 Left 1015629299 6:135215446-135215468 CCAGGTAACCTTGAGTATGGCGC 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1015629305 6:135215489-135215511 AAATTGCCTGGTCTGTAAAATGG No data
1015629299_1015629303 8 Left 1015629299 6:135215446-135215468 CCAGGTAACCTTGAGTATGGCGC 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1015629303 6:135215477-135215499 TCTCTTCCTTTCAAATTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015629299 Original CRISPR GCGCCATACTCAAGGTTACC TGG (reversed) Intronic
905002858 1:34686744-34686766 GTGACATACTCAAGGTCACATGG - Intergenic
907331910 1:53677091-53677113 GCGTCATCCTCAAGGGTAGCGGG - Intronic
922554337 1:226521465-226521487 GGGCCACACTCAATGTTAGCAGG + Intergenic
923857054 1:237856567-237856589 CAGACATACTGAAGGTTACCCGG - Intergenic
1080644792 11:34180689-34180711 GCGCCTTGCTCAAGGTTACACGG + Intronic
1084455755 11:69267404-69267426 ACCCCAGACTCAAGGTTGCCTGG + Intergenic
1089607840 11:119651947-119651969 GGGCCTTGCTCAAGGTCACCTGG + Intronic
1096598155 12:52710425-52710447 GGGCCAGTCTCAAGGTTACAGGG + Intergenic
1103740625 12:123088848-123088870 GAGACATACACAAGGTTCCCTGG - Intronic
1110108243 13:71707873-71707895 GAGCCATACTCAAGGGCACATGG + Intronic
1125904715 15:43380310-43380332 GAGCCATAATAAAGGTTACATGG - Intronic
1128535204 15:68485275-68485297 GCGCCAAACGCAAGGTTGGCAGG - Intergenic
1141629648 16:85280255-85280277 AGGCCTTACTCAAGGTCACCTGG - Intergenic
1148612021 17:48970952-48970974 GCCCCAGACTCAGGGTTCCCAGG - Intergenic
1152664483 17:81559374-81559396 GCGCCGTACTCATGGAGACCTGG + Exonic
928209383 2:29312365-29312387 TCGCTATACTCAAGGTCTCCAGG + Intronic
935644804 2:105325398-105325420 GTGGCTTGCTCAAGGTTACCTGG + Intronic
943625593 2:190195821-190195843 TCGCCAAACCCAAGGTTATCTGG + Intronic
944919471 2:204396312-204396334 CCTTCATACTCAAGGTCACCCGG - Intergenic
1172684964 20:36746439-36746461 GAGCCATACCCAAGGTCACAGGG + Intergenic
963330264 3:143906081-143906103 TTGCCATACTCAAGGTTACTTGG + Intergenic
972782098 4:42295032-42295054 ACACCATACTCAAGATAACCAGG + Intergenic
993256678 5:85600415-85600437 TCACCAAACTCAAGGTCACCAGG - Intergenic
1007068666 6:39018675-39018697 GCACCATCCTCCAGGTCACCTGG + Intronic
1013428705 6:110037134-110037156 GCGCCATCCTCAGAGTCACCAGG + Intergenic
1015629299 6:135215446-135215468 GCGCCATACTCAAGGTTACCTGG - Intronic
1018296954 6:162358302-162358324 TTGCCATACTGAAAGTTACCTGG + Intronic
1019493303 7:1324974-1324996 GGGCCATACTCACAGGTACCAGG - Intergenic
1020841087 7:13218834-13218856 GTGACTTACTCAAGGTTACAAGG + Intergenic
1047956898 8:129983578-129983600 GGGCCACACTCAGGGTGACCTGG - Intronic
1060149064 9:121275899-121275921 GGGCCATACTCATGCTTAACTGG - Intronic
1060337529 9:122739890-122739912 CTGCCATACTCAAGGTCATCTGG - Intergenic
1061513148 9:131072908-131072930 GAGTCATACCCAAGGTCACCAGG - Intronic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1192862566 X:75092499-75092521 TTGCCAAACCCAAGGTTACCTGG - Intronic
1195412601 X:104584254-104584276 GGGACATGCTCAAGGTTACAGGG + Intronic
1198970769 X:142276844-142276866 GGGCAATACTCAAGTTTACCAGG - Intergenic
1199760234 X:150899064-150899086 GAGCCCTTCTCAAGGTCACCCGG - Intergenic