ID: 1015629652

View in Genome Browser
Species Human (GRCh38)
Location 6:135219208-135219230
Sequence CAGTTACACTTTAAAGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 2, 3: 60, 4: 388}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015629650_1015629652 16 Left 1015629650 6:135219169-135219191 CCTACTTTTGTTTTCTCTCTTAT 0: 1
1: 0
2: 13
3: 124
4: 1423
Right 1015629652 6:135219208-135219230 CAGTTACACTTTAAAGAAAATGG 0: 1
1: 0
2: 2
3: 60
4: 388
1015629648_1015629652 27 Left 1015629648 6:135219158-135219180 CCCTTATTTTACCTACTTTTGTT 0: 1
1: 0
2: 0
3: 75
4: 868
Right 1015629652 6:135219208-135219230 CAGTTACACTTTAAAGAAAATGG 0: 1
1: 0
2: 2
3: 60
4: 388
1015629649_1015629652 26 Left 1015629649 6:135219159-135219181 CCTTATTTTACCTACTTTTGTTT 0: 1
1: 0
2: 6
3: 82
4: 836
Right 1015629652 6:135219208-135219230 CAGTTACACTTTAAAGAAAATGG 0: 1
1: 0
2: 2
3: 60
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015629652 Original CRISPR CAGTTACACTTTAAAGAAAA TGG Intergenic
901564444 1:10101355-10101377 GAGTTACACTTTCATGAATAAGG - Intronic
903763305 1:25714769-25714791 CAGCTACACTCTAAAGGAAGTGG + Intronic
905785064 1:40748833-40748855 CAGTTCCATTTTACAGACAATGG + Intronic
906919215 1:50046377-50046399 CAGTTACCCTTTCAAAAAACAGG + Intergenic
907167486 1:52426948-52426970 CAGTTACACTGTGTTGAAAATGG - Intronic
908034721 1:60039632-60039654 TAGTTACAGATTCAAGAAAATGG - Intronic
908326258 1:63026901-63026923 GAGCAACACATTAAAGAAAATGG - Intergenic
908443712 1:64181546-64181568 CATTTACATTTTATAGAAAGAGG + Intergenic
909856563 1:80540249-80540271 CTGTTCTACTTTAAAGACAAAGG - Intergenic
910780743 1:90929819-90929841 CGATTACACTTAAAAGTAAATGG + Intronic
911396004 1:97311143-97311165 TAGTTTTCCTTTAAAGAAAATGG - Intronic
911840045 1:102670538-102670560 CAGGTAAATTTCAAAGAAAATGG + Intergenic
911909343 1:103612940-103612962 CAATTAGACATGAAAGAAAAAGG + Intergenic
911991488 1:104703600-104703622 CAGACAAACTTTAAAAAAAAGGG + Intergenic
913314107 1:117535498-117535520 CAGTCACGTTTTAAAGGAAAGGG - Intergenic
914443536 1:147728592-147728614 CAGTTTCACTTTGAAGCAAAAGG + Intergenic
914462861 1:147900896-147900918 CAATTCCATTTTAAATAAAATGG - Intergenic
916943188 1:169697921-169697943 GAGTTTCATTTTGAAGAAAAAGG + Intronic
917065222 1:171085503-171085525 CAGTAACACTTTATAACAAAAGG - Intergenic
917227114 1:172796137-172796159 CACTTGCATTTTAAAAAAAAGGG - Intergenic
917694081 1:177501998-177502020 CAGTTGCACTTTAAAGAGATGGG + Intergenic
917899366 1:179526936-179526958 GGGTTTCACTTTAAAGATAATGG + Intronic
918372262 1:183872651-183872673 CGGATACACTTTAAAGAGAAAGG + Intronic
918927521 1:190807321-190807343 TAATTCCAATTTAAAGAAAAGGG + Intergenic
920187221 1:204167279-204167301 CAGTTCAACTTTAAAAAAAATGG + Intergenic
920797869 1:209158175-209158197 CAGCTCCCCTTTGAAGAAAAGGG - Intergenic
922285032 1:224163384-224163406 CAGTTACACCTTTAAGGAACAGG - Intergenic
922865450 1:228857475-228857497 TATTTAGAGTTTAAAGAAAAAGG + Intergenic
924488526 1:244512388-244512410 CAGATAGATATTAAAGAAAAAGG - Intronic
924905433 1:248447037-248447059 CAGTTACCATTTAAATAAATAGG + Intergenic
1064423214 10:15207978-15208000 CAGCTACTTTTTAAGGAAAATGG - Intergenic
1065457424 10:25921916-25921938 CAGTTATACTTTATAGAGCATGG - Intergenic
1066558763 10:36645598-36645620 AAGTTACACTTGGAGGAAAAGGG + Intergenic
1068450714 10:57183617-57183639 CACTGACAGATTAAAGAAAATGG + Intergenic
1068582805 10:58761422-58761444 CAGTTTCTCTTTAAAGGAAATGG + Intronic
1068628872 10:59279103-59279125 CAGTAATACTTTATAGAACACGG - Intronic
1070205690 10:74258820-74258842 GAATAACAATTTAAAGAAAAAGG - Intronic
1070220995 10:74444437-74444459 TATTTACTCTTTCAAGAAAAAGG - Intronic
1070331448 10:75420376-75420398 CAGTTAGAGGTCAAAGAAAATGG - Intergenic
1070441478 10:76450013-76450035 TAGCTAAACTATAAAGAAAATGG - Intronic
1072226168 10:93371732-93371754 CCTTTATACTTTAAAAAAAAAGG - Intronic
1072683387 10:97522714-97522736 CAGGTACAATCTAAAGAGAAAGG - Intronic
1073522606 10:104148116-104148138 GAGAAACATTTTAAAGAAAAAGG + Intronic
1075127917 10:119715634-119715656 CAGTTTCACCCTAAACAAAATGG - Intergenic
1075461478 10:122619257-122619279 CAGATGCACTATACAGAAAATGG - Intronic
1075664572 10:124221396-124221418 CATTTCCACTTTACAGATAAAGG + Intergenic
1076661827 10:132060433-132060455 CATTTACAATTTTAAAAAAATGG + Intergenic
1077238474 11:1497266-1497288 CAGTAACACTTTAAATCAAAAGG + Intronic
1077753585 11:5001368-5001390 CATATATATTTTAAAGAAAATGG + Intergenic
1077762586 11:5119153-5119175 AAGTTAAAAATTAAAGAAAAGGG + Intergenic
1077914493 11:6602413-6602435 CATTTACACATTGAAGAAAGTGG - Intronic
1078397878 11:10997924-10997946 AAGTTACACTTCAATCAAAAGGG - Intergenic
1079639853 11:22791468-22791490 CACATACACTTTAATGGAAATGG - Intronic
1079852181 11:25548779-25548801 AAGTTTCACTTTAAAGTCAAAGG + Intergenic
1079967041 11:26992622-26992644 CAGTTACATTTCAAGGAAGAAGG + Intergenic
1080674129 11:34409091-34409113 CAGTCACATTTGAATGAAAAGGG - Intergenic
1080716357 11:34805558-34805580 TACTTACATTTTACAGAAAAGGG + Intergenic
1081238843 11:40679264-40679286 CTGTTTCCCTTTAAAAAAAAAGG - Intronic
1081879905 11:46440291-46440313 GAGCTATACTGTAAAGAAAAAGG + Intronic
1082674890 11:56085092-56085114 AAGTTACACGTTTAACAAAATGG + Intergenic
1083195595 11:61084217-61084239 CATTTAAAGTTCAAAGAAAAGGG + Intergenic
1083585225 11:63852826-63852848 CATTTAGAGTTTAAAGAAAAAGG + Intronic
1085192527 11:74640500-74640522 CATTTACTCTATGAAGAAAATGG - Intronic
1085972869 11:81614092-81614114 CAGATACACTAAAAATAAAAAGG + Intergenic
1086031276 11:82359422-82359444 TAGTTACATTTTTAAGGAAAGGG - Intergenic
1086206430 11:84263628-84263650 GAGTTATACCTTATAGAAAATGG - Intronic
1086409728 11:86532344-86532366 GAATTACACTTTGAACAAAATGG + Intronic
1086595807 11:88569263-88569285 CAGTTAGACTTGAAAGAAAATGG + Intronic
1087023981 11:93631839-93631861 AAGTTAAACTAGAAAGAAAAAGG - Intergenic
1087336984 11:96856257-96856279 AAGATACACTTTAGTGAAAAGGG + Intergenic
1088301553 11:108363338-108363360 CAAATACACTGAAAAGAAAAGGG - Intronic
1088505102 11:110519851-110519873 CAGTTACATTTTAAAGAAACTGG + Intergenic
1089074998 11:115731068-115731090 CAGAGACACTTTGAAGAATATGG + Intergenic
1089089349 11:115856142-115856164 CATTTTCAATTTAAATAAAATGG + Intergenic
1090613441 11:128492791-128492813 CAGTTTTACTTTAGAGAAAAGGG + Intronic
1090694157 11:129220286-129220308 CAGTTAAATTTTAAGGCAAAAGG + Intronic
1091439792 12:503809-503831 CTTTTACACTTTTAAGAAGAAGG - Intronic
1091689907 12:2588858-2588880 CAGGTACACACTAAAAAAAAAGG + Intronic
1092841632 12:12548124-12548146 CTGATTCACATTAAAGAAAAAGG + Intronic
1094156869 12:27346567-27346589 GAGTAACACTTTAAAAACAAAGG - Intronic
1094262167 12:28513251-28513273 CACTTACTCTTTAAAGAATCAGG - Intronic
1094651521 12:32382227-32382249 CAATTACACTTTGAATAATAAGG - Intronic
1096274131 12:50191171-50191193 CAATTTCACCTTAAAGATAATGG - Intronic
1097462648 12:59881369-59881391 CAGTTTGACATTAAAGAGAATGG - Intergenic
1097527272 12:60752895-60752917 CTGATATACTTTGAAGAAAATGG - Intergenic
1097851240 12:64412368-64412390 CTGTTATTATTTAAAGAAAATGG + Intronic
1098300931 12:69053578-69053600 CAGTTTCACTTAAAAGAAATGGG - Intergenic
1098480732 12:70956912-70956934 AAGCTGCACTTTAAACAAAATGG + Intergenic
1098815656 12:75158742-75158764 TAGTTACACTTCAAAGGGAAAGG + Intronic
1099165806 12:79306001-79306023 GAGAGACTCTTTAAAGAAAATGG - Intronic
1099195827 12:79614604-79614626 CAGTTTCACTTTAATAAAACAGG + Intronic
1099219721 12:79898484-79898506 CCCTTACACTATGAAGAAAATGG + Intronic
1101449166 12:104760787-104760809 CATTGAAACTTTAAAAAAAATGG + Exonic
1101505605 12:105343452-105343474 CAGATACAGTTTAAAGCAAATGG + Intronic
1101938237 12:109077537-109077559 AAGTCACACTTTAAATACAAAGG - Intronic
1102047031 12:109835765-109835787 CTGTCTCAATTTAAAGAAAATGG + Intergenic
1102163829 12:110790235-110790257 TATTTAAACTATAAAGAAAAGGG - Intergenic
1103312759 12:120025010-120025032 CACACACACTTTAAAGAAGAAGG - Intronic
1104176128 12:126334491-126334513 CAGTTACACCAGAGAGAAAATGG - Intergenic
1104258299 12:127159668-127159690 CAGTGACACTTTGAATAGAATGG + Intergenic
1105160522 13:17425370-17425392 CAGTTACAGTTTCAACCAAAAGG - Intergenic
1105162103 13:17450337-17450359 CAGTTACAGTTTCTACAAAAAGG - Intergenic
1105168801 13:17556058-17556080 CAGTTACAGTTTCTACAAAAAGG - Intergenic
1105197757 13:18006804-18006826 CAGTTACAGTTTCTACAAAAAGG - Intergenic
1105197875 13:18008680-18008702 CAGTTACAGTTTCTACAAAAAGG - Intergenic
1105241570 13:18613386-18613408 CATTCATTCTTTAAAGAAAAAGG - Intergenic
1105364790 13:19754922-19754944 CAGGAACCCTTTAAAAAAAATGG + Intronic
1106687171 13:32073010-32073032 CAGGAGCACTTAAAAGAAAAAGG + Intronic
1106691017 13:32116746-32116768 CATTTGTTCTTTAAAGAAAAAGG + Intronic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1107303696 13:38994808-38994830 GAATTTCAATTTAAAGAAAAGGG - Intergenic
1108754318 13:53481505-53481527 TATTTACACATTAAAGGAAAAGG + Intergenic
1108877558 13:55065636-55065658 CAATTACACGTGAAGGAAAAGGG - Intergenic
1109157441 13:58928234-58928256 CACATAGACGTTAAAGAAAAAGG + Intergenic
1109265065 13:60188544-60188566 CAGTTGCCCTTTAGAGTAAATGG - Intergenic
1109325460 13:60861983-60862005 CAGCTACATTTTAAAGAAAGAGG - Intergenic
1110320324 13:74153856-74153878 CACTTAAACTTGAAAGTAAAGGG - Intergenic
1110514924 13:76399064-76399086 CAGTAACACTTTGCAGAATAAGG + Intergenic
1110718697 13:78737446-78737468 CACTTACATTTGATAGAAAAGGG + Intergenic
1110802357 13:79713752-79713774 CATTTAAAGTTTGAAGAAAAAGG + Intergenic
1112172624 13:96990229-96990251 CACTTAAACTTGAAAGAAAATGG + Intronic
1112799741 13:103097331-103097353 CAGTTTCCCTTTATAGAAAATGG - Intergenic
1113105795 13:106770642-106770664 CTGCTACACTTTGAAGGAAAAGG - Intergenic
1114065432 14:19055345-19055367 CATTCATTCTTTAAAGAAAAAGG - Intergenic
1114096831 14:19344657-19344679 CATTCATTCTTTAAAGAAAAAGG + Intergenic
1114153842 14:20077127-20077149 GAGCTACACCTTAAAGAAAATGG + Intergenic
1115025212 14:28736904-28736926 CAGTTTCACTTAGAAGGAAAAGG - Intergenic
1115187967 14:30713977-30713999 CAGTTACTCTTTAGAGAAACTGG + Intronic
1115213815 14:30994649-30994671 AAGTTACACTTTAAAAAAACAGG + Intronic
1115302182 14:31896935-31896957 AAGTTACTCTTTAAAGGAAAAGG + Intergenic
1115437502 14:33392027-33392049 CATTTTTAGTTTAAAGAAAATGG + Intronic
1116431262 14:44847765-44847787 ATGTTAGACTTTAAAGAACAAGG - Intergenic
1117137277 14:52748471-52748493 CAAATACAGTTTAAATAAAAGGG + Intronic
1117239424 14:53814229-53814251 AAGTTTTACTTTTAAGAAAATGG - Intergenic
1117554261 14:56868525-56868547 CTGTTACGCTTTCAAGAAACAGG + Intergenic
1118433676 14:65748933-65748955 CAGGTAAAGTTTAAAGAACAAGG + Intergenic
1120008199 14:79383895-79383917 CTGTTACATTATAAAGGAAAGGG - Intronic
1120339047 14:83195330-83195352 CACAAACACTTTCAAGAAAAAGG + Intergenic
1120642086 14:87027815-87027837 CAGTTAAAATTTACAGAACAGGG + Intergenic
1120715596 14:87837768-87837790 CAGATAACTTTTAAAGAAAAGGG + Intergenic
1121672228 14:95720473-95720495 GAGCTACACTTTAGACAAAATGG - Intergenic
1121855821 14:97269322-97269344 TAGCTACACTTGAAAGAAACTGG + Intergenic
1202830682 14_GL000009v2_random:26116-26138 CAGTAAAACTGAAAAGAAAAAGG + Intergenic
1123813904 15:23956975-23956997 CTCTAACAATTTAAAGAAAATGG - Intergenic
1123954403 15:25319773-25319795 CAATTACACTTTAGACCAAACGG - Intergenic
1125183774 15:36907651-36907673 AAGCTACAATTTAAAGAAAGCGG - Intronic
1125432733 15:39612138-39612160 GAATTACACTTTAAATCAAATGG + Intronic
1127255025 15:57282792-57282814 CTGCCACACTTTGAAGAAAATGG - Intronic
1134895187 16:17879912-17879934 AAGTCACAATTTAAAGACAAAGG - Intergenic
1135243867 16:20837260-20837282 CAATTAGACTTTAAACAAAACGG - Intronic
1135777032 16:25265901-25265923 CTGTAACACTTTAAGTAAAATGG - Intergenic
1137362483 16:47831572-47831594 CAGGTGCACTATAAAGAAATGGG - Intergenic
1137977618 16:53044421-53044443 AAGTTACAGATTAAACAAAAGGG - Intergenic
1138243673 16:55449409-55449431 CAATTATACTTTAATTAAAAAGG - Intronic
1138388585 16:56653352-56653374 CAGTTCCATTTTACAGAAGATGG - Intronic
1139378615 16:66516249-66516271 GAGTAACACTTTAAAGACAAAGG + Intronic
1140247683 16:73266047-73266069 CACTTACTCTTTACAGCAAAGGG + Intergenic
1140672182 16:77290331-77290353 CAGTTAAACTTTATAAAAACAGG + Intronic
1140873888 16:79132248-79132270 AAGTTACATTTTACATAAAAAGG + Intronic
1141011924 16:80409550-80409572 CACTGACCCTTTAAAGAATATGG + Intergenic
1142846246 17:2679089-2679111 CATCTACACATTAAAGAAAAAGG - Intronic
1144229753 17:13189815-13189837 CATTTACATTTTAGAGTAAATGG + Intergenic
1144516545 17:15921250-15921272 CACTTACAATTTAAAGCAACAGG + Intergenic
1146595376 17:34163802-34163824 TAGCTACACTCTACAGAAAATGG + Intronic
1148384759 17:47226324-47226346 CAGTGAGACCTTAAAGGAAAAGG + Intergenic
1153368833 18:4290324-4290346 CAGGTGCAATTTAAAGAATATGG + Intronic
1154447388 18:14446520-14446542 CATTCATTCTTTAAAGAAAAAGG + Intergenic
1156879837 18:42063676-42063698 CAGTTAAACTGTAATGATAATGG - Intronic
1157835252 18:50895872-50895894 CATTTGCACATAAAAGAAAAAGG + Exonic
1158047310 18:53171685-53171707 CAGGTATACTTTAAAGGAAAGGG - Intronic
1158099707 18:53817077-53817099 AAGTTTCACTTTAATGGAAAAGG + Intergenic
1158164754 18:54528032-54528054 CAGAAACAGTTTTAAGAAAAAGG - Intergenic
1158209622 18:55032960-55032982 CAGTCAGACATTAAAGGAAACGG + Intergenic
1158277972 18:55789584-55789606 CAGTTTCATTTTAAAGACAGAGG - Intergenic
1158382583 18:56950058-56950080 CAGTTATGCTTTCAAGTAAATGG + Intronic
1158675422 18:59513694-59513716 TGGCTACACTTTAGAGAAAACGG + Intronic
1158684235 18:59598604-59598626 CAGTGACTCTTCAAAGAAAACGG - Intronic
1159678466 18:71316582-71316604 GAGTAACAATTAAAAGAAAAAGG + Intergenic
1160146666 18:76371203-76371225 CAGTTACTCTCTAATTAAAATGG + Intronic
1160332333 18:78005963-78005985 CAGTAGCACTTTCAATAAAACGG - Intergenic
1161510249 19:4666576-4666598 CAGTTTTACTTTTAAGAAAATGG + Intronic
1164317250 19:24102166-24102188 AAGTCACAATATAAAGAAAATGG - Intronic
1165214150 19:34257627-34257649 AACTTACACTTCAGAGAAAACGG - Intronic
1165406111 19:35632403-35632425 CAGTTACACTAAACTGAAAAGGG + Intronic
1167136533 19:47619568-47619590 GAATTACACTTCAATGAAAAAGG - Intronic
926769172 2:16352709-16352731 CAGTCACAACTTAACGAAAATGG - Intergenic
927480022 2:23445982-23446004 CATTTGCAATTTAGAGAAAAAGG - Intronic
927642539 2:24854466-24854488 GATTTACACTTTAAACAAAGAGG - Intronic
927828730 2:26329436-26329458 CTGATGCACTTTAAAGATAAAGG + Intronic
928323025 2:30298438-30298460 CACTTAGAGTTTAAAGAAAGGGG + Intronic
929369031 2:41198880-41198902 CAGCTAAACTATAAACAAAATGG - Intergenic
929676212 2:43933068-43933090 CATTTACATTTTCTAGAAAATGG - Intronic
930689510 2:54346031-54346053 CAGTGCCACTTGAAAAAAAATGG - Intronic
931083167 2:58798690-58798712 CAGTTTCACTCTAAATAAAAAGG + Intergenic
932005804 2:67925948-67925970 CAGTTATCCTTTAGAGAGAATGG - Intergenic
932053755 2:68424238-68424260 AAGTTACACTACAGAGAAAATGG + Intergenic
934473730 2:94578501-94578523 AAGTTAAACTTTTAAGAAAAGGG - Intergenic
935249404 2:101248439-101248461 CAGTTATAACTTAAGGAAAAAGG + Intronic
935397641 2:102624668-102624690 CAGTGACACTTGAAAGGAGATGG - Intronic
935418492 2:102843007-102843029 CAGATACTCTTTACAGAAAATGG + Intronic
937636251 2:124158400-124158422 CAGATAGGATTTAAAGAAAAGGG - Intronic
938197597 2:129343412-129343434 CAGATACACTTTAGATTAAAAGG + Intergenic
939005496 2:136781872-136781894 CAGCTACACTTTGAAGGAAAGGG - Intronic
939792945 2:146602482-146602504 CAGTCACAATTTAGAGTAAAGGG - Intergenic
940393357 2:153159128-153159150 CAGTTTTAGTATAAAGAAAATGG - Intergenic
940589956 2:155710411-155710433 CAGTTTCAGTTTAAAGAAAGAGG - Intergenic
940799271 2:158115502-158115524 CAGTTACAAAGTAAAGAGAAAGG - Intronic
940832810 2:158486956-158486978 CAGTAACATTTTAAATACAAAGG + Intronic
941002366 2:160215346-160215368 TATTAACACTTTAAATAAAAAGG - Intronic
941538538 2:166753232-166753254 CATATACAGTTTTAAGAAAAGGG + Intergenic
942009083 2:171740548-171740570 CACTGACCCTCTAAAGAAAAGGG - Intronic
943293866 2:186112287-186112309 AAGTTACACTTTAGACCAAATGG - Intergenic
943450793 2:188039754-188039776 CAGTTACTTTTTAGATAAAATGG - Intergenic
944006460 2:194914130-194914152 CATTTGCAAATTAAAGAAAATGG + Intergenic
944563499 2:200964300-200964322 CAGCTACCTTTTGAAGAAAAAGG + Intergenic
945310733 2:208309299-208309321 CAGTTAAACATAAAAGAATAAGG + Intronic
946216894 2:218191142-218191164 CAGTTACAGGTTAAAGAAGTTGG - Intergenic
946584345 2:221167708-221167730 CAATTAAAAATTAAAGAAAAAGG - Intergenic
947645012 2:231732388-231732410 CAGGTTCACTTTCCAGAAAAAGG + Intergenic
949038999 2:241836987-241837009 CAGTAACACTTTAAATACAAAGG + Intergenic
1169351141 20:4868917-4868939 CAGTTACAGTTTATATAAATAGG - Intronic
1170726041 20:18927607-18927629 CAATTACACTATTAAGAGAAAGG - Intergenic
1171118914 20:22551124-22551146 CATTTCCACTTTACAGAAGAGGG - Intergenic
1171206556 20:23286308-23286330 CAGTAAAAATTTAAGGAAAAAGG + Intergenic
1172999101 20:39092676-39092698 CACTTACACTTTAAAAAAACAGG - Intergenic
1173356564 20:42298253-42298275 CAATTTCACTTATAAGAAAAAGG + Intronic
1174497861 20:50961567-50961589 CATTTAAGCTTTAAAAAAAATGG - Exonic
1176448805 21:6844149-6844171 CATTCATTCTTTAAAGAAAAAGG - Intergenic
1176609870 21:8870954-8870976 CAGTAAAACTGAAAAGAAAAAGG + Intergenic
1176826975 21:13709172-13709194 CATTCATTCTTTAAAGAAAAAGG - Intergenic
1177075017 21:16560988-16561010 CATTTACACTGTAAACAACATGG - Intergenic
1177110926 21:17027429-17027451 CATTTACAATTTAAAAGAAAGGG + Intergenic
1177333875 21:19698758-19698780 CAGTTAATCTTTACAAAAAAGGG - Intergenic
1177459054 21:21386395-21386417 CAATGAAACTTTAAAGAAGATGG + Intronic
1177501922 21:21967837-21967859 CAGTTACACATCTAAGAATAAGG + Intergenic
1178039947 21:28629229-28629251 CAGTGAGACTTTAGAGAAAGAGG - Intergenic
1178056146 21:28800470-28800492 CAGTTACACTTTTAATATAATGG - Intergenic
1178087590 21:29127883-29127905 CAGTTACATATTAAACACAACGG - Intronic
1179369161 21:40788367-40788389 AAGTTACACTTTAACACAAAGGG - Intronic
1180483922 22:15777965-15777987 CATTCATTCTTTAAAGAAAAAGG - Intergenic
1182173570 22:28258652-28258674 GAGTAACACTTTACAGAAGAGGG + Intronic
1184863591 22:47190566-47190588 CAGTCATACCTTGAAGAAAATGG - Intergenic
1185135304 22:49067771-49067793 CACTTTCATTTTAAAGAAATAGG - Intergenic
949860601 3:8501549-8501571 CCGTTGCCCTTTAAAGGAAAAGG + Intergenic
950131779 3:10552252-10552274 GAGCTACTCTGTAAAGAAAAGGG + Intronic
951223249 3:20092084-20092106 GAACTATACTTTAAAGAAAATGG - Intronic
951613593 3:24519476-24519498 TAGTTTCACTTTGAAGCAAAGGG - Intergenic
952580560 3:34828556-34828578 CATTTGTAATTTAAAGAAAATGG + Intergenic
953197192 3:40745710-40745732 CAGTGAGACTTTAAGGAAGATGG - Intergenic
953541712 3:43825146-43825168 CAGTAACACTTTAATTAATATGG - Intergenic
955515732 3:59724716-59724738 CAGTTCCTCTTCAAAGAACATGG + Intergenic
956920738 3:73926579-73926601 CACTTAGACGTTCAAGAAAAGGG + Intergenic
956929536 3:74027347-74027369 CAGTTACACTGGCGAGAAAACGG - Intergenic
957228075 3:77474470-77474492 CAGTTGTGTTTTAAAGAAAAAGG - Intronic
958092718 3:88897196-88897218 AAGTAACACATTAAAGAAGAGGG + Intergenic
958148016 3:89652534-89652556 CATTTAAAATTTAAAGAAATTGG + Intergenic
958153740 3:89726022-89726044 CACTTACACTTGAAAAAAATAGG + Intergenic
958463593 3:94429578-94429600 CATTAATACTTGAAAGAAAAGGG - Intergenic
958684985 3:97380603-97380625 CATTTACTCTTAAAGGAAAAAGG + Intronic
959364351 3:105437931-105437953 CATTTATATTTTAAAGGAAATGG + Intronic
959710565 3:109381738-109381760 CAATTACAATTGAAACAAAAAGG + Intergenic
960568426 3:119160537-119160559 CAGATACTCTTTAAGGGAAAAGG - Intronic
960769423 3:121176248-121176270 CATTTCCACTTTTAAAAAAATGG - Intronic
961082541 3:124038586-124038608 CCTTTGCACCTTAAAGAAAAAGG - Intergenic
961544520 3:127623123-127623145 GAGTTACTTTTTAAAGGAAAAGG + Intergenic
961794043 3:129396831-129396853 AAGTGAAACTTTAATGAAAAGGG - Intergenic
961941991 3:130647345-130647367 CAGATACAATTTAGAGAGAAGGG - Intronic
962934989 3:140072276-140072298 CAATTCCATTTGAAAGAAAAAGG + Intronic
963261400 3:143195062-143195084 CAGTTAAAAGTTAAATAAAATGG - Intergenic
964078068 3:152716213-152716235 GAGTTACAATTAATAGAAAATGG - Intergenic
964078300 3:152720019-152720041 TTGTTACACTTTAAAGAACTTGG + Intergenic
964876703 3:161375546-161375568 CATTTACACCTTGTAGAAAAGGG - Intergenic
965724992 3:171705995-171706017 CTCTTGCTCTTTAAAGAAAAAGG + Intronic
965970493 3:174549178-174549200 CAATGCAACTTTAAAGAAAATGG + Intronic
966659622 3:182399914-182399936 CAGAAACACTTTCAAGAAAGTGG + Intergenic
967085700 3:186093278-186093300 AGGTTACACTTTACAGAAAAGGG + Intronic
967580311 3:191145515-191145537 CAAAAACACTTGAAAGAAAATGG + Intergenic
967628312 3:191712116-191712138 CTGTTACAGTTCAAAGACAAAGG - Intergenic
967697338 3:192547404-192547426 CAGAGACTCTATAAAGAAAATGG - Intronic
968679666 4:1908550-1908572 CAGATAATCTTAAAAGAAAAGGG + Intronic
969200682 4:5602620-5602642 AAGTTATACAGTAAAGAAAAAGG + Intronic
970064218 4:12073216-12073238 CAATTACATTTTAAGGTAAACGG + Intergenic
970452708 4:16187568-16187590 CAGTGACACTTGAAAGAAATTGG - Intronic
970854587 4:20637398-20637420 AAGTAAAACTCTAAAGAAAAAGG + Intergenic
971042184 4:22766114-22766136 ATGTTACATTTTTAAGAAAATGG + Intergenic
972494215 4:39618222-39618244 AACTTACACCATAAAGAAAAAGG + Intronic
973655472 4:53043256-53043278 CAGTGACAAGTGAAAGAAAAGGG + Intronic
974381904 4:61151741-61151763 CATTTGTACTTTAAAGAGAATGG + Intergenic
974776180 4:66484866-66484888 CAGTTTCACTATAAAGATAAGGG - Intergenic
975556463 4:75670752-75670774 CAGTTACAGTAAAAAGAAAGAGG + Intronic
976349153 4:84040850-84040872 CAGTTATACTTTAATTAAAATGG + Intergenic
976582404 4:86753044-86753066 CAAGTACCCTTAAAAGAAAATGG + Exonic
976799800 4:88976174-88976196 CAGTTATTCATTAAAGAGAAAGG - Intronic
977426500 4:96873319-96873341 CAGTTACCAGTGAAAGAAAATGG + Intergenic
977563823 4:98561558-98561580 CAGCGACACTTTAAAGAATGGGG + Intronic
977649808 4:99456428-99456450 CAGAAATACTTTAAATAAAATGG + Intergenic
977979951 4:103309647-103309669 CAGCAAAACTTTAAAGGAAATGG + Intergenic
978138590 4:105292768-105292790 TAGCTACACTTTAGAGAAGATGG + Intergenic
978965377 4:114734599-114734621 CAGTTACAATTTAAGTAAATTGG + Intergenic
979296147 4:119034611-119034633 CAGTCCCACTTTATAGAAGAGGG + Intronic
979672348 4:123373207-123373229 CTGTTTAAGTTTAAAGAAAAAGG + Intergenic
980213799 4:129824722-129824744 GAGTTACCCTAGAAAGAAAAAGG + Intergenic
980481983 4:133399079-133399101 CAATTACCCTTTAAAGACAGTGG + Intergenic
980782075 4:137503963-137503985 GAATTACATGTTAAAGAAAACGG + Intergenic
981069290 4:140517962-140517984 CAGTTTCACTGTTAACAAAATGG + Intergenic
983646361 4:169995749-169995771 CAGTTACAGTTTAAAATACATGG - Intronic
984212826 4:176871458-176871480 CAGGTACATTTGAAAGAAACAGG + Intergenic
984817897 4:183855490-183855512 AAGTTACACTTTCCAGGAAAAGG - Intronic
985325663 4:188766111-188766133 AAGTTACATTTTAAAGTATATGG + Intergenic
986458942 5:7949745-7949767 CAGTTATATTTTAAAGAAATCGG - Intergenic
986774502 5:11001640-11001662 GAGCTACAATTAAAAGAAAAAGG - Intronic
986878629 5:12142201-12142223 TAGTATGACTTTAAAGAAAATGG + Intergenic
987783632 5:22470296-22470318 CAGCTACATTTATAAGAAAATGG - Intronic
988174881 5:27709373-27709395 CTCTTACCCTTTAAAGATAAGGG - Intergenic
989693302 5:44170735-44170757 CAGTTTCTCTTCAAAGACAATGG - Intergenic
989975253 5:50578179-50578201 CAGTTCAACTTTAGAGAAAATGG + Intergenic
990174833 5:53095993-53096015 CAGCCTGACTTTAAAGAAAATGG + Intronic
990189841 5:53247528-53247550 AAGTTACATTTAAAAGAAAAGGG + Intergenic
991385630 5:66085878-66085900 CAATTAGTCTTTACAGAAAATGG - Intergenic
991944257 5:71884110-71884132 TGGTGACATTTTAAAGAAAATGG + Intergenic
992053203 5:72960228-72960250 AACCTATACTTTAAAGAAAAAGG - Intronic
993379104 5:87185816-87185838 AAGTTTCATTTTAAACAAAAAGG + Intergenic
994011052 5:94902999-94903021 CAGTAACTCATGAAAGAAAAGGG + Intronic
995050327 5:107696259-107696281 AATTTACATTTTAAAGGAAATGG + Intergenic
995152849 5:108870460-108870482 CAGACACAATTTAAAGAAAAGGG - Intronic
997734741 5:136204964-136204986 CAGTTTCACTGAAGAGAAAAGGG - Intergenic
998932106 5:147192760-147192782 AAGTTACTCTTTAAAATAAAAGG - Intergenic
999549132 5:152665063-152665085 GAATTACACTTTAAACTAAATGG + Intergenic
999917463 5:156278703-156278725 CAGTTACACTGCAATGAAAAAGG - Intronic
1000206032 5:159059713-159059735 CAGTTCTACTGTAATGAAAAGGG + Intronic
1000375093 5:160573432-160573454 CTTTTATACTTTAAAGAAGAGGG + Intronic
1000656165 5:163880772-163880794 CATTTATATTTTAAAGATAAAGG + Intergenic
1001351312 5:170968554-170968576 CACTCAATCTTTAAAGAAAATGG - Intronic
1002349434 5:178573204-178573226 CAATTATACTTCAAAAAAAAAGG + Intronic
1004419540 6:15455831-15455853 TAGTTACTCTTTAAAGAACCTGG - Intronic
1004776321 6:18849731-18849753 CTCTTACGGTTTAAAGAAAATGG - Intergenic
1005107374 6:22238644-22238666 CAAGTTCAGTTTAAAGAAAAGGG + Intergenic
1005178087 6:23070885-23070907 TAGTTAGATTTTAGAGAAAAGGG - Intergenic
1006694796 6:35921498-35921520 GAGATACTATTTAAAGAAAATGG + Intergenic
1007023735 6:38548494-38548516 CATTTTCATTTTAAAGGAAAAGG - Intronic
1007329682 6:41095729-41095751 TTATTACACTGTAAAGAAAAGGG - Intronic
1007803652 6:44420175-44420197 ATGTTACATTTTAATGAAAAAGG + Intronic
1007868663 6:45006486-45006508 GAGGTAAACATTAAAGAAAATGG - Intronic
1009288338 6:61851607-61851629 CAGCTACAAGTCAAAGAAAAAGG + Intronic
1009511441 6:64554338-64554360 CATTTTCAATTTGAAGAAAAAGG + Intronic
1009728606 6:67567624-67567646 GAGTTATACTTCAAAGAAGAGGG - Intergenic
1010099039 6:72080840-72080862 TACTTACACTTTAAAAAAACAGG + Intronic
1010383780 6:75254645-75254667 CAGTTATATTTTAAATCAAAAGG - Exonic
1010613378 6:77984130-77984152 CAGTTCTAACTTAAAGAAAATGG + Intergenic
1010768327 6:79801262-79801284 CAGATGGACTTTGAAGAAAATGG + Intergenic
1010822103 6:80427468-80427490 CAATTATATTTTAAAGAAATTGG + Intergenic
1011046120 6:83084979-83085001 CAGTTACACTTTTAAAAAACTGG - Intronic
1012274795 6:97260102-97260124 CTGTTTCACTTTAAACATAAAGG - Intronic
1012958077 6:105592348-105592370 CTGTTAGACTTATAAGAAAAGGG + Intergenic
1013943872 6:115698836-115698858 AAGTTCCACTGTAGAGAAAATGG + Intergenic
1014531621 6:122565792-122565814 CAATTTTAATTTAAAGAAAAAGG + Intronic
1015047141 6:128789440-128789462 AAATTACACTGTTAAGAAAATGG - Intergenic
1015422852 6:133031006-133031028 CATTTACAGTTGAAACAAAAAGG - Intergenic
1015629652 6:135219208-135219230 CAGTTACACTTTAAAGAAAATGG + Intergenic
1016245841 6:141979960-141979982 CAAATACACTTTAAAAAAAATGG + Intergenic
1016687960 6:146902597-146902619 CATTGAAACTTTAAATAAAAGGG - Intergenic
1017123243 6:151043877-151043899 AAGTTAAACTTTTAAGAAAAGGG + Intronic
1017123661 6:151046879-151046901 AAGTTAAACTTTTAAGAAAAGGG + Intronic
1017433153 6:154391106-154391128 CAGCTACACACTAAAGAAAGAGG - Exonic
1018708705 6:166482406-166482428 CAGTTGCATTTGAAAGGAAAGGG - Intronic
1019914868 7:4126305-4126327 CAGTGAAACTTTAAAAACAAGGG - Intronic
1020183604 7:5941843-5941865 CAATTACAGTTTATCGAAAAAGG - Intronic
1020299309 7:6782927-6782949 CAATTACAGTTTATCGAAAAAGG + Intronic
1023552104 7:41381420-41381442 CAGTGACGCTGTAAAGTAAATGG - Intergenic
1023637166 7:42223931-42223953 AAGTTACACTTTTAAGACAAAGG + Intronic
1027469278 7:78553467-78553489 CAGTAACACTTTAATGACAGAGG - Intronic
1028161950 7:87496124-87496146 CAGGTACATTTGAAAGAATAAGG + Intergenic
1028277134 7:88870767-88870789 CAGTTACACATTGCAAAAAAAGG + Intronic
1028370017 7:90080983-90081005 CAGTTTCACTATCAAGAATAAGG + Intergenic
1028396980 7:90380511-90380533 CAATTACACTTTAATAAAACTGG - Intronic
1028739308 7:94253870-94253892 CATTTCCATTTTAAAGATAAAGG + Intergenic
1028795790 7:94901707-94901729 GATTTACACTTTGAAAAAAAAGG - Intergenic
1028942111 7:96533189-96533211 CAGTTTCATTTTGATGAAAAAGG - Intronic
1030009736 7:105154120-105154142 CAGTTAGAGATGAAAGAAAAAGG - Intronic
1030549655 7:110942455-110942477 CAGTTAAACTTTAATTAAACAGG - Intronic
1031087329 7:117315713-117315735 CATTCAGACTGTAAAGAAAAAGG - Intronic
1031190907 7:118549523-118549545 TAATTCCACTTTAAAGGAAATGG + Intergenic
1031349222 7:120708158-120708180 CAGTGACAAGTAAAAGAAAATGG + Intronic
1031848955 7:126840330-126840352 CAGTTAGCTTTTAAATAAAAAGG - Intronic
1032100540 7:128972992-128973014 AAGTTGCTCTTTAAAAAAAAAGG + Intronic
1032206182 7:129868057-129868079 GAATTTCAGTTTAAAGAAAAAGG + Intronic
1032580752 7:133101156-133101178 CAGTTTTACTGTAAAGAAAAAGG + Intergenic
1034109632 7:148523840-148523862 TAGATACAGTTTATAGAAAAGGG - Intergenic
1034925283 7:155116285-155116307 CAGTTCCACTTTAGGGTAAAAGG - Intergenic
1035008770 7:155692198-155692220 CAGTAAAAATTAAAAGAAAATGG + Intronic
1038297461 8:26308520-26308542 CAGTTTCTTTTTAAAGAAAATGG - Intronic
1040454601 8:47583904-47583926 CAGTTTCACTGTAAAGGAAAAGG - Intronic
1040911459 8:52523062-52523084 CAGTCTCATTTTAAAGATAAAGG - Intergenic
1041694151 8:60717957-60717979 CAGTTAAATTTAAAAAAAAATGG - Intronic
1041959111 8:63591680-63591702 AAACTACACTTTAGAGAAAATGG - Intergenic
1042232447 8:66571977-66571999 TATTTACAAGTTAAAGAAAAAGG + Intronic
1042484069 8:69332297-69332319 CAGTTACCCTTTAAAATTAAAGG + Intergenic
1043317596 8:78940598-78940620 CAGTTACACTTTCAGCTAAATGG - Intergenic
1043332803 8:79138543-79138565 CAGATATACATTATAGAAAAAGG + Intergenic
1043401937 8:79892252-79892274 GACTTACACATTAAATAAAAGGG - Intergenic
1043787061 8:84416567-84416589 CATTTACACATGAAAAAAAAAGG - Intronic
1044132347 8:88539902-88539924 CAGTTCTAAATTAAAGAAAATGG + Intergenic
1044161649 8:88924809-88924831 GAGTTACACACAAAAGAAAATGG - Intergenic
1044309796 8:90680417-90680439 CAGTGAGACTTTAAATAGAATGG - Intronic
1044603271 8:94026688-94026710 TAGTTACACAATAAAGCAAATGG - Intergenic
1045157978 8:99500846-99500868 CTGTTCAACTTTAAATAAAAGGG + Intronic
1045223455 8:100221492-100221514 AAGTTACACTTTAAGCAAATGGG - Intronic
1045607797 8:103797177-103797199 GAGTTAGGCTTTGAAGAAAAAGG - Intronic
1046001884 8:108431611-108431633 CAGTAAAATTTTAAGGAAAAGGG - Intronic
1046024432 8:108705148-108705170 CAGATACTCAGTAAAGAAAAGGG - Intronic
1046531749 8:115455102-115455124 CACTTACACCTTAAAGTACAAGG - Intronic
1047697691 8:127419156-127419178 CAGTCACACTTAAAATAAAAAGG + Exonic
1049461339 8:142729805-142729827 AAGTTAAACTTCCAAGAAAAAGG - Intronic
1050247106 9:3702492-3702514 CAGTTAAAATTTAAAAAAAATGG - Intergenic
1051613937 9:18989254-18989276 CAGTTTCACTTAAAAGCAATAGG - Intronic
1052542240 9:29826432-29826454 CATTTACACATAAAAGAAAAAGG - Intergenic
1053684600 9:40510011-40510033 AAGTTAAACTTTTAAGAAAAGGG + Intergenic
1053934568 9:43138289-43138311 AAGTTAAACTTTTAAGAAAAGGG + Intergenic
1054279125 9:63114954-63114976 AAGTTAAACTTTTAAGAAAAGGG - Intergenic
1054395711 9:64649984-64650006 AAGTTAAACTTTTAAGAAAAGGG + Intergenic
1054430355 9:65155179-65155201 AAGTTAAACTTTTAAGAAAAGGG + Intergenic
1054500025 9:65866342-65866364 AAGTTAAACTTTTAAGAAAAGGG - Intergenic
1055142249 9:72888916-72888938 ATGGTACAATTTAAAGAAAAAGG - Intergenic
1058190918 9:101914815-101914837 CATTTACACTTTACACAAAAAGG + Intergenic
1058553216 9:106138036-106138058 CAGTTGCACTTTTAACAACACGG + Intergenic
1059910409 9:119037329-119037351 TTGTTACACTATTAAGAAAAAGG + Intergenic
1060097687 9:120807052-120807074 GAGCTACACTTTAGACAAAATGG - Intergenic
1060582843 9:124767777-124767799 TAATTACACTTTAGAGGAAATGG - Intronic
1187003259 X:15204446-15204468 GAGTTACACTTGGAAGAAAATGG + Intergenic
1187703094 X:21982948-21982970 CAGTTATAATTTTAAGAAACTGG - Intronic
1188186260 X:27118901-27118923 CACTTACTCTTCAATGAAAAAGG + Intergenic
1188427474 X:30065683-30065705 AAGTTAGACTGAAAAGAAAAGGG + Intergenic
1188445820 X:30252171-30252193 CAGTTATTATTTAAAGAAGATGG + Intergenic
1191721104 X:64229691-64229713 TAGTAACACATTAAATAAAAAGG + Intronic
1193794795 X:85860418-85860440 TATTCACACTTTAAAAAAAATGG - Intergenic
1194784763 X:98068945-98068967 CAGTTGCAATTTAAACAAATTGG + Intergenic
1195062400 X:101209023-101209045 TAGTTACTGTTTAAAGACAATGG + Intergenic
1196101403 X:111850955-111850977 AAGTAACACTGTAAAGTAAAGGG - Intronic
1196968308 X:121082502-121082524 CAGTGAGACTTTGAATAAAATGG + Intergenic
1197820395 X:130535675-130535697 CATTTAAAGTTAAAAGAAAAAGG + Intergenic
1197896770 X:131324426-131324448 CATTTACACCTTAAGGAACAAGG - Intronic
1198144803 X:133844407-133844429 CAGTCACACTTTAACAAAACTGG + Intronic
1198676777 X:139139612-139139634 CAAATATACCTTAAAGAAAAAGG + Intronic
1199559220 X:149145704-149145726 CAGTCACACTTTGAAGATTAAGG + Intergenic
1200314496 X:155117514-155117536 CGGTTACTTTTCAAAGAAAAGGG + Intronic
1200382199 X:155849765-155849787 TAGTTCCACCTTAAAAAAAAAGG + Intergenic
1200386421 X:155895448-155895470 CAGTTTGACTTGAAAGAAACAGG + Intronic
1200852175 Y:7894510-7894532 CAGTTTCCTTTTAAATAAAAGGG + Intergenic
1201320217 Y:12690258-12690280 CATTAACACATAAAAGAAAATGG - Intergenic
1201417101 Y:13758221-13758243 AAGTTACAATTTAAAAAAAAAGG - Intergenic
1201553665 Y:15245811-15245833 CTCTTACAGTTTAAAAAAAATGG - Intergenic