ID: 1015631613 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:135237268-135237290 |
| Sequence | GCACTCTGGGAGGCTGAGGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1015631613_1015631621 | 19 | Left | 1015631613 | 6:135237268-135237290 | CCTGCCTCAGCCTCCCAGAGTGC | No data | ||
| Right | 1015631621 | 6:135237310-135237332 | TGCCATGCTCAGCACCATGAGGG | No data | ||||
| 1015631613_1015631620 | 18 | Left | 1015631613 | 6:135237268-135237290 | CCTGCCTCAGCCTCCCAGAGTGC | No data | ||
| Right | 1015631620 | 6:135237309-135237331 | CTGCCATGCTCAGCACCATGAGG | No data | ||||
| 1015631613_1015631623 | 30 | Left | 1015631613 | 6:135237268-135237290 | CCTGCCTCAGCCTCCCAGAGTGC | No data | ||
| Right | 1015631623 | 6:135237321-135237343 | GCACCATGAGGGTTTCTTGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1015631613 | Original CRISPR | GCACTCTGGGAGGCTGAGGC AGG (reversed) | Intergenic | ||