ID: 1015631613

View in Genome Browser
Species Human (GRCh38)
Location 6:135237268-135237290
Sequence GCACTCTGGGAGGCTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015631613_1015631621 19 Left 1015631613 6:135237268-135237290 CCTGCCTCAGCCTCCCAGAGTGC No data
Right 1015631621 6:135237310-135237332 TGCCATGCTCAGCACCATGAGGG No data
1015631613_1015631620 18 Left 1015631613 6:135237268-135237290 CCTGCCTCAGCCTCCCAGAGTGC No data
Right 1015631620 6:135237309-135237331 CTGCCATGCTCAGCACCATGAGG No data
1015631613_1015631623 30 Left 1015631613 6:135237268-135237290 CCTGCCTCAGCCTCCCAGAGTGC No data
Right 1015631623 6:135237321-135237343 GCACCATGAGGGTTTCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015631613 Original CRISPR GCACTCTGGGAGGCTGAGGC AGG (reversed) Intergenic