ID: 1015631615

View in Genome Browser
Species Human (GRCh38)
Location 6:135237272-135237294
Sequence TCCAGCACTCTGGGAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015631615_1015631620 14 Left 1015631615 6:135237272-135237294 CCTCAGCCTCCCAGAGTGCTGGA No data
Right 1015631620 6:135237309-135237331 CTGCCATGCTCAGCACCATGAGG No data
1015631615_1015631621 15 Left 1015631615 6:135237272-135237294 CCTCAGCCTCCCAGAGTGCTGGA No data
Right 1015631621 6:135237310-135237332 TGCCATGCTCAGCACCATGAGGG No data
1015631615_1015631623 26 Left 1015631615 6:135237272-135237294 CCTCAGCCTCCCAGAGTGCTGGA No data
Right 1015631623 6:135237321-135237343 GCACCATGAGGGTTTCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015631615 Original CRISPR TCCAGCACTCTGGGAGGCTG AGG (reversed) Intergenic