ID: 1015631616

View in Genome Browser
Species Human (GRCh38)
Location 6:135237278-135237300
Sequence TATAATTCCAGCACTCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015631616_1015631626 28 Left 1015631616 6:135237278-135237300 CCTCCCAGAGTGCTGGAATTATA No data
Right 1015631626 6:135237329-135237351 AGGGTTTCTTGATGGTTGAAGGG No data
1015631616_1015631627 29 Left 1015631616 6:135237278-135237300 CCTCCCAGAGTGCTGGAATTATA No data
Right 1015631627 6:135237330-135237352 GGGTTTCTTGATGGTTGAAGGGG No data
1015631616_1015631620 8 Left 1015631616 6:135237278-135237300 CCTCCCAGAGTGCTGGAATTATA No data
Right 1015631620 6:135237309-135237331 CTGCCATGCTCAGCACCATGAGG No data
1015631616_1015631621 9 Left 1015631616 6:135237278-135237300 CCTCCCAGAGTGCTGGAATTATA No data
Right 1015631621 6:135237310-135237332 TGCCATGCTCAGCACCATGAGGG No data
1015631616_1015631623 20 Left 1015631616 6:135237278-135237300 CCTCCCAGAGTGCTGGAATTATA No data
Right 1015631623 6:135237321-135237343 GCACCATGAGGGTTTCTTGATGG No data
1015631616_1015631625 27 Left 1015631616 6:135237278-135237300 CCTCCCAGAGTGCTGGAATTATA No data
Right 1015631625 6:135237328-135237350 GAGGGTTTCTTGATGGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015631616 Original CRISPR TATAATTCCAGCACTCTGGG AGG (reversed) Intergenic