ID: 1015631623

View in Genome Browser
Species Human (GRCh38)
Location 6:135237321-135237343
Sequence GCACCATGAGGGTTTCTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015631613_1015631623 30 Left 1015631613 6:135237268-135237290 CCTGCCTCAGCCTCCCAGAGTGC 0: 1480
1: 65247
2: 182713
3: 235131
4: 276111
Right 1015631623 6:135237321-135237343 GCACCATGAGGGTTTCTTGATGG No data
1015631615_1015631623 26 Left 1015631615 6:135237272-135237294 CCTCAGCCTCCCAGAGTGCTGGA 0: 98
1: 6878
2: 102811
3: 223232
4: 246726
Right 1015631623 6:135237321-135237343 GCACCATGAGGGTTTCTTGATGG No data
1015631616_1015631623 20 Left 1015631616 6:135237278-135237300 CCTCCCAGAGTGCTGGAATTATA 0: 42
1: 2616
2: 50315
3: 346940
4: 247450
Right 1015631623 6:135237321-135237343 GCACCATGAGGGTTTCTTGATGG No data
1015631619_1015631623 16 Left 1015631619 6:135237282-135237304 CCAGAGTGCTGGAATTATAGGTA No data
Right 1015631623 6:135237321-135237343 GCACCATGAGGGTTTCTTGATGG No data
1015631618_1015631623 17 Left 1015631618 6:135237281-135237303 CCCAGAGTGCTGGAATTATAGGT 0: 14
1: 713
2: 15174
3: 127950
4: 339636
Right 1015631623 6:135237321-135237343 GCACCATGAGGGTTTCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015631623 Original CRISPR GCACCATGAGGGTTTCTTGA TGG Intergenic
No off target data available for this crispr