ID: 1015631890

View in Genome Browser
Species Human (GRCh38)
Location 6:135239458-135239480
Sequence CTCCCAAAGCAGTCAGGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015631888_1015631890 -10 Left 1015631888 6:135239445-135239467 CCTGGGCTTTAAACTCCCAAAGC No data
Right 1015631890 6:135239458-135239480 CTCCCAAAGCAGTCAGGCATTGG No data
1015631887_1015631890 2 Left 1015631887 6:135239433-135239455 CCAGACAAGTTTCCTGGGCTTTA No data
Right 1015631890 6:135239458-135239480 CTCCCAAAGCAGTCAGGCATTGG No data
1015631884_1015631890 9 Left 1015631884 6:135239426-135239448 CCAGACACCAGACAAGTTTCCTG No data
Right 1015631890 6:135239458-135239480 CTCCCAAAGCAGTCAGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015631890 Original CRISPR CTCCCAAAGCAGTCAGGCAT TGG Intergenic
No off target data available for this crispr