ID: 1015636329

View in Genome Browser
Species Human (GRCh38)
Location 6:135278644-135278666
Sequence TAGTCCTTAATTCCAGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015636327_1015636329 6 Left 1015636327 6:135278615-135278637 CCTAAATTATAAAAATATATTTA No data
Right 1015636329 6:135278644-135278666 TAGTCCTTAATTCCAGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015636329 Original CRISPR TAGTCCTTAATTCCAGCTAC TGG Intergenic
No off target data available for this crispr