ID: 1015641452

View in Genome Browser
Species Human (GRCh38)
Location 6:135337890-135337912
Sequence TAGAATATTTGGATTGACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 250}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015641452_1015641455 11 Left 1015641452 6:135337890-135337912 CCAAAGTCAATCCAAATATTCTA 0: 1
1: 0
2: 2
3: 21
4: 250
Right 1015641455 6:135337924-135337946 CGTACATGCATATGAGCATTTGG No data
1015641452_1015641457 19 Left 1015641452 6:135337890-135337912 CCAAAGTCAATCCAAATATTCTA 0: 1
1: 0
2: 2
3: 21
4: 250
Right 1015641457 6:135337932-135337954 CATATGAGCATTTGGTTTATGGG No data
1015641452_1015641458 20 Left 1015641452 6:135337890-135337912 CCAAAGTCAATCCAAATATTCTA 0: 1
1: 0
2: 2
3: 21
4: 250
Right 1015641458 6:135337933-135337955 ATATGAGCATTTGGTTTATGGGG 0: 1
1: 0
2: 0
3: 9
4: 208
1015641452_1015641456 18 Left 1015641452 6:135337890-135337912 CCAAAGTCAATCCAAATATTCTA 0: 1
1: 0
2: 2
3: 21
4: 250
Right 1015641456 6:135337931-135337953 GCATATGAGCATTTGGTTTATGG 0: 1
1: 0
2: 0
3: 7
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015641452 Original CRISPR TAGAATATTTGGATTGACTT TGG (reversed) Intronic
903593459 1:24475225-24475247 TAAAATATTTAGATTGAGATTGG + Intergenic
904635036 1:31873514-31873536 TAAAATATTTAGAATGTCTTTGG - Intergenic
905550436 1:38833557-38833579 TCGAATATCTGTCTTGACTTTGG - Intergenic
906701569 1:47862658-47862680 TTGAATATGTAGATTGAGTTGGG - Intronic
908501730 1:64749910-64749932 TAGATTATTTGTGTTCACTTAGG + Intronic
909183674 1:72457488-72457510 TAGAATTATTGGAATGTCTTAGG + Intergenic
909266694 1:73568761-73568783 TAGAAAATTTTGATTCACTTAGG - Intergenic
909610587 1:77547736-77547758 AACTATATTTGGAATGACTTGGG - Intronic
909731313 1:78894455-78894477 AAGAATATTTAAATTGATTTAGG + Intronic
910125421 1:83836642-83836664 TAGAATATTTAGATTAATTGGGG - Intergenic
910263748 1:85316508-85316530 TAGGATATTTGGACTGAAATTGG - Intergenic
910862641 1:91757672-91757694 TATAATAATTGTATTGACTATGG + Intronic
912041159 1:105392411-105392433 TTGAATCTTTAGATTGATTTGGG + Intergenic
916968370 1:169979336-169979358 TAGCATATTTGTATTTACTTTGG - Intronic
917531052 1:175835350-175835372 TAAAATATTTTGATTTCCTTTGG - Intergenic
917945324 1:179963888-179963910 TAGAATTTTTGGATTGTTTTGGG + Intronic
918419225 1:184346144-184346166 TAAAATATTTAGAATAACTTTGG + Intergenic
918745822 1:188197954-188197976 TAGAATATTTGCATAGCATTGGG - Intergenic
918754949 1:188328216-188328238 TATACTAGTTGGACTGACTTTGG + Intergenic
919248641 1:195023499-195023521 TTGAATATTTAGATTGCTTTGGG - Intergenic
919870993 1:201821235-201821257 TAGGATATTTGGATTCAGTCAGG - Exonic
921484516 1:215700099-215700121 TAGATTATGTTTATTGACTTAGG + Intronic
921683512 1:218062625-218062647 TATTATATTTGGATAGATTTTGG - Intergenic
922307773 1:224358890-224358912 TAGAATAGTTGCACTAACTTAGG + Intronic
924079475 1:240379066-240379088 TAGAATATTTGGCTTTCTTTAGG + Intronic
924537627 1:244950837-244950859 TAAAATATTTGCAATGAATTGGG - Intergenic
1063245742 10:4216437-4216459 TGGATTGATTGGATTGACTTAGG + Intergenic
1066570486 10:36766146-36766168 TAGAATTTTTCCATAGACTTGGG + Intergenic
1068848143 10:61704242-61704264 TAGAATATTTGGAAGAATTTGGG - Intronic
1069230019 10:65997194-65997216 TAGAATTAATGGATTTACTTAGG - Intronic
1070392863 10:75986336-75986358 TGGAATACCAGGATTGACTTAGG + Intronic
1071929404 10:90450894-90450916 TAAAATATTTAGTTTGACTCAGG - Intergenic
1073929978 10:108564664-108564686 TAGAAGAGTTGAAATGACTTTGG + Intergenic
1075238043 10:120749642-120749664 TAGAATAGTTAGATTTTCTTTGG + Intergenic
1076517245 10:131053422-131053444 TAAAATATTTTGATTTCCTTGGG - Intergenic
1077878809 11:6331226-6331248 AAGTATATTTGGAATTACTTGGG - Intergenic
1078286057 11:9957362-9957384 TAGATTATTTGCTTTGAATTTGG + Intronic
1078674137 11:13393684-13393706 TATGATATTGGGCTTGACTTTGG - Intronic
1080002119 11:27362104-27362126 TAAAATAAGTGGATTGATTTAGG + Intronic
1082691163 11:56306968-56306990 TAGATTCCTTGGATTGAGTTTGG + Intergenic
1084287207 11:68140037-68140059 AAGAACATTTGCAATGACTTGGG - Intergenic
1085969956 11:81576746-81576768 TACAATATCTTGCTTGACTTGGG - Intergenic
1085979735 11:81709660-81709682 TGGAATATTTGCACTGAATTGGG + Intergenic
1086376405 11:86205089-86205111 TAAAATACTTGGATAGCCTTAGG - Intergenic
1087905098 11:103686457-103686479 TTGAATTTGTAGATTGACTTTGG - Intergenic
1087990546 11:104742420-104742442 TAGAAGATTTGGAGTGATTTGGG + Intergenic
1088020803 11:105116326-105116348 TTGAATGTGTGGATTGCCTTAGG - Intergenic
1088133029 11:106518838-106518860 ATGAATATTTGGATTGTCATTGG - Intergenic
1088708900 11:112488583-112488605 TAGAATAGTTGGATTTATTGCGG - Intergenic
1092316414 12:7419785-7419807 TTGAATTTTTAGATTGCCTTTGG - Intronic
1093347268 12:18053557-18053579 TATAATATGAGGATTGGCTTAGG - Intergenic
1095852192 12:46822775-46822797 TAGAATGTTTGTATAGAGTTTGG + Intronic
1100730921 12:97467866-97467888 TAAAAGATTTGAATTGGCTTTGG + Intergenic
1101356645 12:103984662-103984684 TAGAATATTTGTCTTTATTTGGG - Intronic
1102833476 12:116030225-116030247 AAGAATATGTAGACTGACTTTGG - Intronic
1104355312 12:128079983-128080005 TGGAATATTAAGATTAACTTGGG - Intergenic
1105960522 13:25331252-25331274 TATAATATTGGGACTGTCTTTGG + Intronic
1106679098 13:31991721-31991743 TAGAATATTTGGAATATCGTTGG + Intergenic
1107030056 13:35841625-35841647 CAGAAAATTTGAAATGACTTGGG - Intronic
1108122937 13:47209134-47209156 AAGAGAATTTGGATTGACATTGG - Intergenic
1108874668 13:55030946-55030968 AAGAATATTTGGATGTAGTTAGG + Intergenic
1109108478 13:58285921-58285943 TAGAATTCTTGAATTGATTTTGG + Intergenic
1109621992 13:64922336-64922358 TGGAAGAATTGGTTTGACTTTGG + Intergenic
1112905233 13:104409932-104409954 TAAAATATATAGATTGATTTAGG - Intergenic
1113410679 13:110085783-110085805 TAGAATCTGTGGATTGCTTTTGG - Intergenic
1113648673 13:112017010-112017032 TATTATATTTGGATTTATTTTGG + Intergenic
1114900465 14:27051273-27051295 TAGAATAATTGGAATTCCTTTGG - Intergenic
1114975408 14:28090663-28090685 AAGATTATTTGCATTGACCTTGG - Intergenic
1120468480 14:84892401-84892423 TAGAATATTGGGATCTAGTTGGG - Intergenic
1124712346 15:32025262-32025284 TAGAATTTTTAGATCAACTTGGG - Intergenic
1126562905 15:50063690-50063712 TAGACTATTGTGTTTGACTTTGG + Intronic
1126864712 15:52924096-52924118 TTGAATATGTGGGTTGACTGGGG + Intergenic
1126871856 15:52997739-52997761 TGGTCTATTTGGATAGACTTTGG - Intergenic
1128605850 15:69036169-69036191 TAGCCTATTTGGATTAAGTTGGG + Intronic
1129745632 15:78018249-78018271 TAAAATATTTGCATAGATTTAGG - Intronic
1131324848 15:91432319-91432341 CAGAGTATTTCTATTGACTTAGG + Intergenic
1131755997 15:95563347-95563369 TAGAATTTTTGGTATAACTTTGG - Intergenic
1135516065 16:23135755-23135777 TTGAATATGTAGATTGATTTGGG - Intronic
1135588689 16:23690297-23690319 CAGAATATTTCTATTGAATTCGG + Exonic
1139333692 16:66215499-66215521 CAAAAACTTTGGATTGACTTTGG + Intergenic
1141011041 16:80399574-80399596 TTGAATATGTGGATTGCTTTGGG - Intergenic
1141338509 16:83180209-83180231 TAAAATATGTTGATTGATTTAGG - Intronic
1145821119 17:27836205-27836227 TAGAGTATTTGGTTTGATTGGGG + Intronic
1146089922 17:29866734-29866756 TAGAATATTTGGTTTGCCTAAGG - Intronic
1148317482 17:46715975-46715997 TAGAATTTTTGGTTTTCCTTGGG + Intronic
1149941101 17:60867601-60867623 TAGAATATATGGATTTACCAAGG - Intronic
1151405513 17:73883529-73883551 TGGAATATTTGGATTATGTTCGG - Intergenic
1153935509 18:9916758-9916780 TAGAAAGTTTTGAATGACTTAGG - Intronic
1156161524 18:34364817-34364839 TACAATATTTGTGTTTACTTTGG - Intergenic
1156614162 18:38763742-38763764 TTGAATTTGTGGATTGCCTTTGG - Intergenic
1158094264 18:53753133-53753155 AATAATATTTGCATTGGCTTAGG - Intergenic
1158100096 18:53820765-53820787 TATAATTTTTGCATTGACCTTGG - Intergenic
1158302239 18:56065117-56065139 CAGAAGATTTGGTTTGGCTTAGG + Intergenic
1159290877 18:66417756-66417778 TATAATTTTTTGGTTGACTTAGG + Intergenic
1159510401 18:69391131-69391153 TGGAATTTTTGGAATGACATGGG + Intergenic
1159738850 18:72139689-72139711 AAGAGTATTTGGATTGATATTGG + Intergenic
1161134568 19:2612188-2612210 TTTAATAATTGGATTGACTTTGG + Intronic
1164830731 19:31317964-31317986 TTGAATCTTTGAATTGATTTTGG - Intronic
1168655704 19:58126000-58126022 TAGAAAATTTGGGATGACTTTGG - Intergenic
927063547 2:19446780-19446802 TAGAACATTGTGATTGGCTTTGG + Intergenic
928073052 2:28236949-28236971 TAGAAAATTTTGATTGGCATGGG - Intronic
929618819 2:43334361-43334383 TAGATTATTAGAATTAACTTGGG + Intronic
929938127 2:46309825-46309847 TGGAATCTTTGGGTTGCCTTGGG + Intronic
930874655 2:56201331-56201353 TAGAACGTTTAGATTAACTTTGG + Intronic
932154395 2:69402933-69402955 TAGAATATTTGTATGACCTTCGG - Intronic
933542183 2:83660518-83660540 TAGAATCTGTGGATTAATTTGGG + Intergenic
933551562 2:83783874-83783896 TAAAATGTTTGGATCCACTTTGG + Intergenic
934469849 2:94512785-94512807 TTGGATATTTGGATAGCCTTGGG - Intergenic
935646909 2:105344872-105344894 CAGCCTATTTGCATTGACTTTGG + Intronic
935692396 2:105743928-105743950 TTGAATATTAGGATTTCCTTTGG + Intergenic
936386655 2:112035945-112035967 TTGGATATGTGGTTTGACTTTGG + Intergenic
937633770 2:124132581-124132603 TTGAATATTTGGATAGCCTCAGG - Intronic
938083928 2:128385837-128385859 TAGAAAATTTGGATCAACTAGGG + Intergenic
938834577 2:135087453-135087475 TTGAATATATAGATTAACTTGGG + Intronic
939533536 2:143395312-143395334 TGGAACATTTCTATTGACTTGGG - Intronic
939846536 2:147253123-147253145 AAGAATATTTGGAAGGTCTTGGG - Intergenic
940090993 2:149916830-149916852 TAAAATATTTGGAGTGCCTATGG - Intergenic
941150782 2:161912795-161912817 CAGGATATGTGGATTGACTGTGG + Intronic
941224657 2:162831920-162831942 TAGGACATTTGGTTTCACTTAGG + Intronic
941527732 2:166627651-166627673 TAGATTCTTTGGATTGGTTTTGG + Intergenic
941783493 2:169474543-169474565 TAGAATCTTTGAAATGACTGGGG - Intergenic
942252885 2:174062720-174062742 TAGGATATCTGGTTTGACTGAGG - Intergenic
942569375 2:177297891-177297913 TAGAATAGTTGAATTAAGTTGGG + Intronic
943184699 2:184592773-184592795 TATAAAATTTGGATTCATTTTGG - Intergenic
943373798 2:187050217-187050239 TTGAATCTGTGGATTGCCTTGGG + Intergenic
943393518 2:187301518-187301540 AAGAATATTTTGCTTGATTTTGG + Intergenic
943623202 2:190172469-190172491 TAGAATATTTGGCTTGAATAGGG - Intronic
944176484 2:196834208-196834230 TAGAAAATTAGGTTTGGCTTAGG - Exonic
945345755 2:208713479-208713501 CAGAATAATTGAATTGAGTTTGG - Intronic
945780047 2:214158229-214158251 TAGAATATTATGTTTGACTCAGG - Intronic
946722366 2:222623319-222623341 TAGAATATTTGGTCTTAATTTGG - Intronic
947936498 2:234009311-234009333 GAGTTTATTTGGAGTGACTTCGG + Intronic
1170102151 20:12714081-12714103 AAGAATATTTGTATTTCCTTTGG + Intergenic
1170718963 20:18858606-18858628 TTGAAAATGTGGATTGGCTTTGG + Intergenic
1174236178 20:49094137-49094159 TAGAATGTTTGGAATGGTTTTGG + Exonic
1174881136 20:54280611-54280633 TATATTATTTAAATTGACTTTGG + Intergenic
1177081120 21:16639584-16639606 TAGAATATTTGAAAACACTTTGG + Intergenic
1178045355 21:28687359-28687381 GAAAATAAATGGATTGACTTAGG + Intergenic
1178088938 21:29141128-29141150 TAGAATATTTTGACTGACTTAGG - Intronic
1178510943 21:33204425-33204447 TAGAATATTTGGCCTCAGTTGGG + Intergenic
1178928567 21:36796399-36796421 TAGATCATTTGGACTGACCTAGG - Intronic
1179098079 21:38333456-38333478 TAGAAGATTGGCATTGACTCAGG - Intergenic
949250324 3:1975901-1975923 TAGCATCTTTGCATTGAGTTAGG - Intergenic
949270680 3:2212731-2212753 TTGCATATTTGAATTGACTGAGG + Intronic
949629142 3:5903476-5903498 TAGAATATTTGAGTTGACTTAGG - Intergenic
951109714 3:18787591-18787613 TATATTCTTTGGTTTGACTTAGG - Intergenic
951367389 3:21800310-21800332 TTGAATCTTTAGATTGCCTTGGG + Intronic
952800460 3:37285959-37285981 TAGAATAATTGCATTTATTTAGG + Intronic
957042001 3:75342794-75342816 TAGAATAATTTGTTTGGCTTTGG - Intergenic
958085508 3:88801007-88801029 TAGAATATTTGAGTTGAAGTAGG - Intergenic
958867041 3:99513078-99513100 AAGAATATTTGGAATCAATTTGG + Intergenic
959300787 3:104598155-104598177 TAGAATATTTGGCCTAAGTTAGG + Intergenic
959733880 3:109635446-109635468 TAGATTACTAGGATTGACTTTGG + Intergenic
961853066 3:129840922-129840944 CAGAAAATGTGGAGTGACTTTGG + Intronic
963383121 3:144557115-144557137 TAGAATATTTGGTTTAAATGGGG + Intergenic
963610759 3:147465227-147465249 AAGAATGCTTGGATTGGCTTGGG - Intronic
963679428 3:148355217-148355239 TAGATTATGTGGATTGATTGTGG + Intergenic
964189995 3:153990610-153990632 TTGAATTTTTGGATTGCTTTTGG - Intergenic
967699096 3:192570752-192570774 TAAAATATTTTTATTGATTTTGG + Intronic
969277263 4:6144577-6144599 TATAATACATGGATTGATTTTGG - Intronic
975473564 4:74796392-74796414 CAGAAAATTTGGATTTTCTTGGG - Intergenic
975498607 4:75060141-75060163 TTCAATATTTGGATTGTCTGGGG + Intergenic
976055195 4:81056572-81056594 TAAAATATTCTAATTGACTTTGG - Exonic
976255337 4:83094258-83094280 TATGATATTTGGATTGATTGTGG - Exonic
976627018 4:87196389-87196411 AAGGATATTTTGATTGAATTAGG + Intronic
977100769 4:92811536-92811558 TAGGATATTTGGAATCATTTAGG - Intronic
977279203 4:95018276-95018298 GAGAAGTTTTGGATTGAGTTGGG + Intronic
977442601 4:97088394-97088416 TAAAATATTTGAATTTTCTTTGG - Intergenic
978700631 4:111640367-111640389 TAAAATATTTAGTTTGATTTGGG + Intergenic
978810101 4:112840202-112840224 CAGAATCTTGGGATGGACTTAGG + Intronic
980189717 4:129508819-129508841 TAGAATATATGGATTATCCTAGG - Intergenic
980371377 4:131878209-131878231 TAGATTATTCGGATTTTCTTTGG + Intergenic
981107462 4:140897276-140897298 TAGAATGTGTGCATTGTCTTGGG + Intronic
981783230 4:148448585-148448607 TGGAATATTTGTATTAGCTTTGG + Intergenic
982173667 4:152684948-152684970 CAAAATATTTGGAGAGACTTGGG - Intergenic
982874629 4:160630231-160630253 TGTAAGATTTGGACTGACTTAGG - Intergenic
983396151 4:167198305-167198327 TAGAATATCTGGAATGGCTATGG + Intronic
983436956 4:167728304-167728326 TCAAATATTTGGAATGAGTTAGG + Intergenic
988221439 5:28351288-28351310 TTGAATCTGTGGATTGACTTGGG - Intergenic
988238198 5:28574333-28574355 TAAAATATTTGAATTGACCTAGG - Intergenic
989873508 5:46643979-46644001 TTGGATATTTGTAGTGACTTGGG + Intergenic
989876445 5:46698907-46698929 TTGGATATTTGTAGTGACTTGGG + Intergenic
993550351 5:89266013-89266035 TAGAATATGTAAATTCACTTTGG - Intergenic
993773253 5:91958142-91958164 TAGAAAATTTAGAATTACTTAGG - Intergenic
995005351 5:107186567-107186589 AAAAACATTTGGATTGATTTTGG - Intergenic
995906986 5:117136438-117136460 TGGACTATTAAGATTGACTTTGG + Intergenic
997299035 5:132789004-132789026 TAGCATATTTTGCTTGACTGAGG - Intronic
997527540 5:134563014-134563036 TTGAACATGTGGCTTGACTTTGG - Intronic
999338893 5:150749828-150749850 TTGAACATTTGGATTGTTTTTGG - Intronic
1000135557 5:158346703-158346725 TACATTATTTGGATTTTCTTTGG + Intergenic
1000756301 5:165164999-165165021 TAGTATCTTTGGATAGTCTTCGG - Intergenic
1001165808 5:169365822-169365844 TTGAACTTATGGATTGACTTGGG - Intergenic
1002018898 5:176349166-176349188 TATAATGGTAGGATTGACTTTGG - Intronic
1003010915 6:2426878-2426900 TAGAATATTTTCATAGACTTTGG + Intergenic
1003258669 6:4496280-4496302 CATAATATTCTGATTGACTTGGG - Intergenic
1003725972 6:8764469-8764491 TTGAATATATGGATTAACTTAGG + Intergenic
1004121557 6:12827906-12827928 TAGAATATTTGGATAAATTATGG + Intronic
1006260502 6:32865074-32865096 TAGAATATATGGATTATCTTTGG + Intergenic
1007922876 6:45626613-45626635 TAGCAGATTTGCAATGACTTGGG - Intronic
1007968276 6:46024110-46024132 TAGAATATTTTGAGGGAATTGGG + Intronic
1008010510 6:46462184-46462206 TTGAATATTTGGTATGAGTTTGG + Intronic
1008067695 6:47067685-47067707 TGGATTATATGGATTGATTTTGG - Intergenic
1008364915 6:50666781-50666803 TAGAATAGTTGGAGTGTTTTGGG - Intergenic
1008505734 6:52227840-52227862 TAGACTAATTGAATTGAATTGGG + Intergenic
1008906915 6:56688096-56688118 TAGAATAATTGTATAGAATTTGG - Intronic
1010363277 6:75019641-75019663 TTGAATATTTAGATTGTTTTAGG + Intergenic
1010600864 6:77824358-77824380 AAGAATATATGTAGTGACTTTGG - Intronic
1011819911 6:91240796-91240818 TAGATTATTTTGATTGATTTAGG + Intergenic
1011960655 6:93085091-93085113 TACAATATTTGATTTGACCTAGG - Intergenic
1012742826 6:103041410-103041432 TTGATTATATTGATTGACTTTGG + Intergenic
1014331288 6:120067629-120067651 GAGATTATTTGGTTTCACTTTGG - Intergenic
1015641452 6:135337890-135337912 TAGAATATTTGGATTGACTTTGG - Intronic
1015780119 6:136856639-136856661 TACAATATTTTGATTGGCTTAGG + Intronic
1016673759 6:146739017-146739039 TAGAATATTTTGAATGACCCAGG - Intronic
1016837163 6:148489535-148489557 TTGAATCTTTAGATTGACTTGGG + Intronic
1018317999 6:162576454-162576476 TTGAACATTCAGATTGACTTTGG + Intronic
1021156023 7:17210812-17210834 AAGAATATTTAAAGTGACTTTGG - Intergenic
1021789241 7:24184949-24184971 TTGAATCTATGGATTTACTTAGG - Intergenic
1023532648 7:41174414-41174436 CAGGATATTTGAATTGAGTTAGG + Intergenic
1025500616 7:61289085-61289107 GAGAATATTTGGAGTGCTTTGGG + Intergenic
1025515474 7:61635309-61635331 GAGAATATTTGGAGTGCTTTGGG + Intergenic
1025539812 7:62064135-62064157 GAGAATATTTGGAGTGCTTTGGG + Intergenic
1026441272 7:70446465-70446487 TAGAAAATTTGTATTTACTTTGG + Intronic
1028060499 7:86307920-86307942 TAGAATATTTATATTAACTTAGG - Intergenic
1033015920 7:137671461-137671483 TAGCAGATTTGGTTGGACTTTGG - Intronic
1033626081 7:143110766-143110788 TAGATTATTTGCATTGATTTTGG - Intergenic
1034279205 7:149839908-149839930 TAAAATATTGGGATTGATATTGG + Intronic
1034985160 7:155508333-155508355 TAGAATATTCGAATTAACTCAGG + Intronic
1037299206 8:17433798-17433820 TAAAATATTTTGCTTGAATTGGG + Intergenic
1037811982 8:22092057-22092079 TGGAATATTTGGAATAACTGTGG + Intronic
1038200490 8:25408429-25408451 GACAATGTTTGGATTGACTCAGG - Intronic
1038464116 8:27744038-27744060 TAAAATATTTGTATTAACTGAGG - Intronic
1039266057 8:35825031-35825053 TAGAATGTTTGAATTCTCTTTGG - Intergenic
1045788097 8:105947861-105947883 TAAATTATTTTGATTAACTTGGG - Intergenic
1048455008 8:134569794-134569816 CTGAATATTTGGATTGTCTCAGG - Intronic
1048527963 8:135221774-135221796 TAGAGTATTTGGATTAAGGTAGG + Intergenic
1049137189 8:140913768-140913790 TTGAATCTATGGATTGATTTGGG - Intronic
1050365989 9:4874239-4874261 CAGAATATGTGCATTGATTTAGG + Intronic
1051679533 9:19593360-19593382 GATAAAATTTGGATTGGCTTGGG + Intronic
1053636014 9:40005077-40005099 TAGATTATTGGGATTTTCTTTGG + Intergenic
1054316891 9:63602177-63602199 TAGATTATTGGGATTTTCTTTGG + Intergenic
1054548645 9:66371050-66371072 TAGATTATTGGGATTTTCTTTGG - Intergenic
1055016963 9:71629102-71629124 TAGGGAATTTGGATTGAATTTGG - Intergenic
1056342897 9:85655567-85655589 TACCATCTTTGGAGTGACTTGGG + Intronic
1057480911 9:95445003-95445025 GACAATGTTTGGATTTACTTAGG + Exonic
1058778466 9:108309368-108309390 TGGATTATTAGGATTGATTTGGG + Intergenic
1186420059 X:9418541-9418563 AAGAAAATTGCGATTGACTTTGG - Intergenic
1186529374 X:10279744-10279766 TAAAATATTTGCACTGATTTGGG - Intergenic
1186607800 X:11110173-11110195 TAGAATTTTGGGAGTGACATGGG + Intergenic
1186621956 X:11250966-11250988 GAGGATATTTGGATTAACTAAGG + Intronic
1186949955 X:14613522-14613544 TACAATATTTGCATTGTATTGGG + Intronic
1187837117 X:23443819-23443841 TAGAATCTGTAGATTGTCTTAGG - Intergenic
1187969519 X:24646005-24646027 TGGAATATTTTGATTGGCTGTGG - Intronic
1188399102 X:29722805-29722827 TAAAATATTTTGATTAATTTAGG + Intronic
1188644478 X:32548079-32548101 TAGAATTCTTTGATTGACTATGG - Intronic
1189815390 X:44819404-44819426 AAGAATATTTGGAACAACTTGGG + Intergenic
1191577448 X:62722134-62722156 TTGTATATGTGAATTGACTTGGG - Intergenic
1193136877 X:77981810-77981832 TTGAATTTTTAGATTGATTTTGG + Intronic
1194317447 X:92397995-92398017 TTCAATATTTGGATTTAATTTGG - Intronic
1194321373 X:92450431-92450453 TAGAATCTTTGCCTTGCCTTTGG + Intronic
1194970764 X:100341081-100341103 CAGAATGTTTAGATGGACTTGGG - Intronic
1195888463 X:109667135-109667157 TAGAATAATGGCATTGATTTTGG + Intronic
1196403996 X:115345672-115345694 TAGAATATTTGGATGAATTTTGG + Intergenic
1196715884 X:118810702-118810724 TAGAATAATTTGATTACCTTTGG - Intergenic
1196967253 X:121070256-121070278 TTGAATCTGTGGATTGATTTGGG + Intergenic
1197318505 X:124998258-124998280 TAGAATATATGCATTGAAATTGG + Intergenic
1198102242 X:133432367-133432389 TAGAATACTTGGAATGTCTGTGG - Intergenic
1198105230 X:133455376-133455398 TAGAATACTTGGAATGTCTGTGG + Intergenic
1199001479 X:142643010-142643032 TAGAATTTATAGATTGATTTTGG + Intergenic
1199490404 X:148392352-148392374 TTGAATCTTTAGATTGCCTTGGG - Intergenic
1200330677 X:155293303-155293325 TATAGCATTTGGAATGACTTTGG - Intronic
1200625624 Y:5511306-5511328 TTCAATATTTGGATTTAATTTGG - Intronic
1200629543 Y:5563903-5563925 TAGAATCTTTGCCTTGCCTTTGG + Intronic
1201473981 Y:14361346-14361368 TAGAATACTTGGAATACCTTGGG - Intergenic