ID: 1015643321 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:135362099-135362121 |
| Sequence | ACACCTACACACACACACCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 8698 | |||
| Summary | {0: 1, 1: 9, 2: 378, 3: 1697, 4: 6613} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1015643321_1015643322 | 16 | Left | 1015643321 | 6:135362099-135362121 | CCATGGTGTGTGTGTGTAGGTGT | 0: 1 1: 9 2: 378 3: 1697 4: 6613 |
||
| Right | 1015643322 | 6:135362138-135362160 | ATATATGTATAAAGAAAATGTGG | 0: 1 1: 16 2: 413 3: 3472 4: 7823 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1015643321 | Original CRISPR | ACACCTACACACACACACCA TGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||