ID: 1015643321

View in Genome Browser
Species Human (GRCh38)
Location 6:135362099-135362121
Sequence ACACCTACACACACACACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8698
Summary {0: 1, 1: 9, 2: 378, 3: 1697, 4: 6613}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015643321_1015643322 16 Left 1015643321 6:135362099-135362121 CCATGGTGTGTGTGTGTAGGTGT 0: 1
1: 9
2: 378
3: 1697
4: 6613
Right 1015643322 6:135362138-135362160 ATATATGTATAAAGAAAATGTGG 0: 1
1: 16
2: 413
3: 3472
4: 7823

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015643321 Original CRISPR ACACCTACACACACACACCA TGG (reversed) Intronic
Too many off-targets to display for this crispr