ID: 1015645644

View in Genome Browser
Species Human (GRCh38)
Location 6:135385156-135385178
Sequence CCAGCCTCTAGCTACCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015645644 Original CRISPR CCAGCCTCTAGCTACCATGA TGG Intronic
900360287 1:2285036-2285058 CCAGCCTCCAGATACCCTGGTGG - Intronic
901679035 1:10902550-10902572 GCAGCCAGTAGCTTCCATGAAGG + Intergenic
903668910 1:25024132-25024154 CCAGCCTCTGGCCACCTTGGTGG - Intergenic
903856882 1:26343046-26343068 CCAGCCTCGAACTACCCTTATGG + Exonic
904254516 1:29246273-29246295 CCAGCCTACAGATACCATGGTGG - Intronic
904888060 1:33756630-33756652 CCTGCTTCTACCTACCATGCTGG - Intronic
905446375 1:38030652-38030674 CCACCCTCTATCTCCCATAAGGG - Intergenic
907424398 1:54370168-54370190 CCAGCCACCAGCTTCCAGGAAGG - Intronic
907813627 1:57896981-57897003 CCAGCCTGTAGCTATTAGGATGG - Intronic
908407710 1:63831193-63831215 CCAGCCTCTAGATCCCAGAATGG - Intronic
908701934 1:66911532-66911554 CCATCCTCAAGCTACCTAGAAGG + Intronic
918132967 1:181645271-181645293 CCAGCCTCTAGATAACCTTAAGG - Intronic
920677515 1:208048463-208048485 CCAGCCTGTAGATACCAGGCAGG + Intronic
922732695 1:227959503-227959525 CCAGCCTCTACCTTCAGTGATGG - Intergenic
1063673105 10:8115877-8115899 CCAGCCTCTACATACCTTCAAGG - Intergenic
1065166675 10:22986131-22986153 CCAACCACTAGCATCCATGAAGG + Intronic
1067302439 10:45024377-45024399 CGAGTCTCTGGCTAGCATGATGG + Intergenic
1070401828 10:76059497-76059519 CCAGCCTCTGGCTTCACTGAAGG - Intronic
1075618705 10:123910094-123910116 CCAGCCTCTGTCTGCCATTATGG - Intronic
1075799232 10:125142451-125142473 CCAGCCTCCAGCCACCACTAAGG - Intronic
1078745814 11:14113299-14113321 CCAGCCACCAGCTACCACAATGG + Intronic
1080284800 11:30597799-30597821 CCACCCTCCAGCGACCATGCTGG + Intergenic
1081282262 11:41224228-41224250 CCAACCTCTACCTCCCTTGAAGG + Intronic
1081632721 11:44700766-44700788 CCTGCCTCTGGCTTCCAGGAAGG - Intergenic
1081742379 11:45449656-45449678 ACAGCCTCTGGCTTCCATGGGGG - Intergenic
1083933722 11:65859694-65859716 CCGGCCTCTAGCTGCTATGCCGG - Intronic
1086395515 11:86411402-86411424 CCAGCCACTTGCTATCATAAGGG + Intronic
1090680037 11:129045841-129045863 CCAGCATCTAGGGCCCATGACGG + Intronic
1093058720 12:14580543-14580565 AAAGCCTCTAGTTACCGTGATGG - Intergenic
1096569623 12:52514513-52514535 TCAGCCTAGAGATACCATGAGGG - Intergenic
1097108131 12:56637018-56637040 CCAGCTTCTACCTAACTTGATGG + Intergenic
1097196541 12:57245193-57245215 CCAGCCTGTAGCAGCCATGATGG - Exonic
1098099694 12:67001642-67001664 CCAATCTCTAGTTACCATGTAGG - Intergenic
1099086370 12:78251601-78251623 CCATCCTCAAGCCACCATGCTGG - Intergenic
1100035614 12:90247719-90247741 CTATCCTATAGCTGCCATGATGG - Intergenic
1101819732 12:108174481-108174503 TCAGACTCTGGCTACCATGTGGG - Intronic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1105348322 13:19593932-19593954 CCAGCCTCTAATAACCATAATGG - Intergenic
1107000475 13:35538609-35538631 TCAGTCTCTACCTACCATGCTGG + Intronic
1107480714 13:40783769-40783791 CCAGCCTCTAATAACCATAATGG - Intergenic
1110330968 13:74271870-74271892 CCAGACTCTAGCTAGGAAGAAGG + Intergenic
1113469438 13:110533997-110534019 CCAGCCTCCACCCACCGTGATGG + Intronic
1119900420 14:78254760-78254782 TCTGACTCTGGCTACCATGATGG - Intronic
1122866461 14:104606953-104606975 CCAGACTCTGGCCAACATGAAGG + Intergenic
1127820496 15:62650536-62650558 TCAGTCTCTAACTACCATTAGGG - Intronic
1127968975 15:63944375-63944397 CCAGCCTATAGGTACCTTGGTGG - Intronic
1128933737 15:71727983-71728005 CCAGCCGATTGCTGCCATGAGGG + Intronic
1129612721 15:77073198-77073220 CCAGCCCCTTGCTACAAAGAGGG - Intronic
1130039896 15:80397731-80397753 CCAGCCTCTAGGTCCCATCAGGG + Intronic
1130076332 15:80694088-80694110 CCAGTCTCTAGCTGCCCTGCTGG + Intronic
1137468839 16:48736353-48736375 CCAGCCTGTGGTAACCATGAAGG - Intergenic
1151060248 17:71084133-71084155 CCAGCTTCTAGATACCAAGGTGG - Intergenic
1151124927 17:71834110-71834132 TCATCCGCTAGCTACCTTGAAGG - Intergenic
1151934682 17:77254624-77254646 CCAGCTTATGGCTCCCATGAAGG - Intergenic
1156148294 18:34213132-34213154 TATGCCTCTATCTACCATGAAGG - Intronic
1160210159 18:76871027-76871049 CCACCCTCTAGCCACCATTGCGG - Intronic
1164535513 19:29084007-29084029 CCAGCCTCTGGACACCATGGGGG + Intergenic
927131841 2:20066648-20066670 CCAGGCTGTGGTTACCATGATGG - Intergenic
929121401 2:38486933-38486955 CCAGCCACTTGCTGCCATGCGGG + Intergenic
931538097 2:63300533-63300555 CCAGCCTCTGACTGCCCTGATGG + Intronic
932080027 2:68705634-68705656 GCAGCCTCTTGCAAGCATGAAGG - Intronic
935213803 2:100960264-100960286 CCGGCCTCGTGCTATCATGATGG - Intronic
935688632 2:105710289-105710311 GCAGCCTCCAGATGCCATGATGG + Intergenic
941778562 2:169419379-169419401 CCACCCTCTAGCAATCATGAGGG + Intergenic
942111688 2:172688807-172688829 ACAGCCTCTGGCTGCCATGTGGG - Intergenic
942254335 2:174079629-174079651 CCTGCCTCTAACCATCATGAAGG + Intronic
1168803791 20:661453-661475 CCAGCCTGTAGCTGCCACCAAGG - Intronic
1172605670 20:36212008-36212030 ACAGCATATAGCCACCATGAGGG + Intronic
1179285658 21:39975456-39975478 CCCCCCTCTAGCCACCATGCAGG - Intergenic
1179601934 21:42485133-42485155 CCAGCTTCTAGCACCCATGGTGG - Intronic
1179635160 21:42704050-42704072 CCAGCCTCGTGCTGCCGTGAGGG - Intronic
1181031620 22:20150904-20150926 CCAGCCTCCAGCAGCCATGGAGG - Intergenic
1182116314 22:27758432-27758454 CCTGGCTCCGGCTACCATGATGG + Intronic
1182703877 22:32262436-32262458 GCAGCTTCTAGTTACCCTGATGG + Intergenic
1184036542 22:41920734-41920756 CCAGCCTCTGGCTACCAGGCAGG + Intergenic
952243759 3:31562618-31562640 CCAGCCTACAGCTACTCTGAAGG - Intronic
953198324 3:40754610-40754632 CCCTCCTCTAGCTACTGTGAGGG + Intergenic
954885321 3:53868352-53868374 GCAGCCTCATGCAACCATGAGGG - Exonic
955991471 3:64632367-64632389 CCAGACTATTGCTGCCATGAGGG + Intronic
956931979 3:74053756-74053778 GCAGCCATTTGCTACCATGATGG - Intergenic
958768256 3:98396382-98396404 GAAGTCTCTACCTACCATGAAGG + Intergenic
958786384 3:98600990-98601012 GAAGTCTCTACCTACCATGAAGG + Intergenic
958946731 3:100371173-100371195 CCTGCCTACAGATACCATGAAGG + Intronic
961792191 3:129384254-129384276 CCAGCCTCTGGCTGCCTTGCAGG - Intergenic
965585004 3:170310327-170310349 CCAGTCTCTTGCTATAATGAAGG + Intergenic
965624191 3:170670599-170670621 CCAATCTCCAGCTCCCATGATGG - Intronic
970178442 4:13362896-13362918 TCAGCCTCAATCTACCATGTGGG + Intronic
979845270 4:125501579-125501601 CCAGATTTTAGCTACCATGTTGG - Intergenic
980642239 4:135595950-135595972 CCAGCCTCTAACTGCCTTGATGG + Intergenic
980771646 4:137380754-137380776 CCACCCTAGAGCTAGCATGATGG + Intergenic
985813746 5:2111222-2111244 CCACCCTCTACCCACCATCAAGG + Intergenic
987392197 5:17386902-17386924 CCAGCCTCTGGAGACCATGTGGG - Intergenic
990739010 5:58893410-58893432 GCAGCCACATGCTACCATGAAGG + Intergenic
991971007 5:72141592-72141614 CCAGCCTCTCAGTACCCTGATGG + Intronic
992752927 5:79877588-79877610 CCAGACTCTAGGTCCCATGAGGG - Intergenic
992999482 5:82366220-82366242 CCAGCCTCTCGCTACAGAGAAGG - Intronic
994209627 5:97073439-97073461 CCAGCATCCAGGTACCAAGAGGG + Intergenic
994353372 5:98770302-98770324 CCAGCCACTCGCTCCCAAGAAGG - Intronic
995523291 5:113031072-113031094 TCTGCCTTTAGCTACTATGAGGG + Intronic
998117262 5:139547628-139547650 CCAGCTTCTAGCTACTCGGAAGG - Intronic
998506906 5:142679479-142679501 CTAGCCTCTAACTTTCATGAAGG + Intronic
1002383175 5:178845204-178845226 CCAGCCTCTATCTTCCACTAGGG + Intergenic
1004443095 6:15672239-15672261 GAAGCCTCTTGCTCCCATGAAGG - Intergenic
1004613918 6:17271719-17271741 GGAGCCTCTTGCTACCTTGAGGG + Intergenic
1015645644 6:135385156-135385178 CCAGCCTCTAGCTACCATGATGG + Intronic
1027690807 7:81342639-81342661 CCAGCCTCTAGCGACCATAAAGG - Intergenic
1035015292 7:155760468-155760490 CCAACCTCCAGGTCCCATGAGGG - Intronic
1035528033 8:329375-329397 CCAGCCACAAGCTACCATCTGGG - Intergenic
1036085862 8:5611974-5611996 CCATCCTCCAGGTGCCATGAAGG + Intergenic
1036772267 8:11587366-11587388 CCACCCTATAGCAACCATGATGG + Intergenic
1037005873 8:13779245-13779267 CTAGCCTCTACCTGCCATGGTGG - Intergenic
1039209895 8:35202110-35202132 GCAGACTCTATCTACAATGAAGG - Intergenic
1040112214 8:43571604-43571626 CCTGCCTCAATCTACCCTGAAGG + Intergenic
1040323621 8:46330336-46330358 CAAGGCTCTAGCCCCCATGATGG + Intergenic
1042129056 8:65568499-65568521 GCTGCCTATTGCTACCATGAAGG + Intergenic
1042422637 8:68609828-68609850 CCAGCCACTAGTTTCCAGGAAGG + Intronic
1044415891 8:91939169-91939191 CCAGCCTCCAGCTAGGATGTAGG - Intergenic
1045526659 8:102946169-102946191 CCATCCTCCAGCTTCCATGGTGG + Intronic
1045743432 8:105388118-105388140 CCAGCTTTTAGCCACCTTGAGGG - Intronic
1046209663 8:111052901-111052923 ACAGCCTCCTGCTACCATGCCGG + Intergenic
1047648064 8:126889769-126889791 CCTGCCTCCTGGTACCATGATGG + Intergenic
1048023828 8:130565991-130566013 CCAGCCTCTAGCTTCCATTTGGG + Intergenic
1048188287 8:132264352-132264374 CCAGCCCCCAGCTATCAGGAGGG + Intronic
1049311378 8:141935595-141935617 CCAGCCTCATGCTGCCCTGATGG - Intergenic
1050703723 9:8370766-8370788 CCAGACTTTAGGTCCCATGATGG - Intronic
1060015934 9:120086492-120086514 CCAGCCTCTAGTTCTCATCAAGG + Intergenic
1061178479 9:129010848-129010870 CCAGCCCCCAGCTCCCATGCCGG - Intronic
1061723745 9:132570027-132570049 CCAGCCTCTAGCTGCCTTTTAGG + Intronic
1193018728 X:76766323-76766345 CCAGCCAATTGCTACCATGTAGG + Intergenic
1196381774 X:115098712-115098734 GCAGCCTAGAGCTACAATGATGG - Intergenic
1199688190 X:150283055-150283077 CCACCTTCTTGCTATCATGATGG - Intergenic