ID: 1015649081

View in Genome Browser
Species Human (GRCh38)
Location 6:135434100-135434122
Sequence GAACATATTAATTTTAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 795
Summary {0: 1, 1: 0, 2: 2, 3: 82, 4: 710}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015649081 Original CRISPR GAACATATTAATTTTAAATA TGG Intronic
900012345 1:127336-127358 GTAGATATTAATTTTAGATATGG + Intergenic
900042405 1:483320-483342 GTAGATATTAATTTTAGATATGG + Intergenic
900063846 1:718313-718335 GTAGATATTAATTTTAGATATGG + Intergenic
904097989 1:27996680-27996702 GAACATTTTACTTATAAAAAGGG + Intronic
905756959 1:40518548-40518570 GAAGATGTTAACTTAAAATAAGG - Intergenic
906121113 1:43391520-43391542 GAACATGACTATTTTAAATAAGG - Intronic
906173764 1:43751081-43751103 GAACATCTTAATTTCACAGAAGG + Intronic
907859646 1:58339838-58339860 TTAAATATTAATTTTAAATGAGG - Intronic
907935056 1:59034496-59034518 CAACATATGAATTTTAACCAGGG + Intergenic
908056900 1:60297528-60297550 GAAAATAATTATTTTAAAGAAGG - Intergenic
908183741 1:61631805-61631827 AAACATATAAATTTTAAAATGGG + Intergenic
908273220 1:62440977-62440999 GAACATTTTATTTTTAAGTGAGG + Intronic
908917311 1:69143957-69143979 GAACATTTTAATTTGAAGTGAGG - Intergenic
909497273 1:76292244-76292266 TAATATAATAATTTTAAATTGGG - Intronic
909522975 1:76590613-76590635 AAAATTATTAATTTTAAATATGG - Intronic
909526410 1:76628036-76628058 AAACACACTCATTTTAAATAAGG - Intronic
909869301 1:80719061-80719083 GAAACTATTTATTTTAAAAATGG - Intergenic
909960902 1:81841196-81841218 GAACATTTTTCTTTGAAATAAGG - Intronic
910326420 1:86013370-86013392 GAACATATTAATTATTCAAAAGG - Intronic
910878657 1:91902655-91902677 GAACACATTTATTTCAAATAAGG + Intronic
911124818 1:94331575-94331597 AAAAACATTAATTTTAAAGACGG + Intergenic
911378874 1:97087355-97087377 GGACATCTTAAGTTTAAATTTGG + Intronic
911936235 1:103977732-103977754 CAAAATATTATTTTTAACTATGG + Intergenic
912042147 1:105404718-105404740 GAAGAGAATAATTTTCAATAAGG - Intergenic
912067362 1:105760523-105760545 TATTATACTAATTTTAAATACGG + Intergenic
912082718 1:105957389-105957411 GCACATAATTATTTTAAAAATGG - Intergenic
912098657 1:106178306-106178328 AAACATATTTATTAAAAATAGGG + Intergenic
912215801 1:107609985-107610007 AAACAGATTAAGTTTACATAAGG + Intronic
912240694 1:107904891-107904913 GGAAATAGTTATTTTAAATAGGG + Intronic
912742205 1:112210633-112210655 TAACAAAATAATTTTAAAAATGG + Intergenic
914693014 1:150047977-150047999 AAACATCTTAATTAAAAATAGGG + Intergenic
916286922 1:163117489-163117511 GAAAATATGAATTTAAGATAGGG + Intronic
916380460 1:164204985-164205007 GAACAAAATAATCTTAAAAAGGG + Intergenic
916650105 1:166827297-166827319 GTATATATTTATTTTAATTATGG - Intergenic
918668131 1:187177966-187177988 CAAAATCTAAATTTTAAATAAGG + Intergenic
918737788 1:188088025-188088047 GAAGATTATAATTCTAAATATGG - Intergenic
918776638 1:188640143-188640165 AAAAATAATAATTTTAAATTAGG - Intergenic
918836985 1:189479086-189479108 GAAGATTTTATTTTTATATAAGG - Intergenic
919078549 1:192841550-192841572 GAAGATATTAATTCTGACTAAGG + Intergenic
919402482 1:197137067-197137089 GTAGATATTATTTTTAGATATGG + Intronic
919503737 1:198371462-198371484 GAAAATAATAATTTTAAAAGGGG + Intergenic
919632130 1:199969791-199969813 GGAGATTTTAACTTTAAATATGG + Intergenic
919978702 1:202629145-202629167 GAAAATAATAATTTAAAAAAAGG - Intronic
920754912 1:208720132-208720154 GCCCATATTAATGTAAAATAAGG - Intergenic
920804674 1:209221604-209221626 GAATATATTTTTTTTAAATGAGG + Intergenic
920931089 1:210388861-210388883 GAAGCTATTTATTTTACATACGG - Intronic
921084989 1:211781937-211781959 ATACATATTATTTTTAAAAATGG + Intronic
921317269 1:213904596-213904618 GAACAACTAAATTTTAAAAACGG + Intergenic
921547981 1:216495841-216495863 GAACACATTCATTTAAAAAATGG + Intergenic
922133565 1:222803028-222803050 AAACACATTAATTTTAGATTTGG + Intergenic
922249996 1:223839985-223840007 GAACATATTCATTGAAAATCTGG + Intronic
922260777 1:223943804-223943826 GTAGATATTAATTTTAGATATGG + Intergenic
922385853 1:225081631-225081653 AAACATATTACTATTTAATATGG + Intronic
922736292 1:227981927-227981949 GTAGATATTAATTTTAGATATGG - Intergenic
923297294 1:232607115-232607137 GAACATATTAATTTTATAATAGG - Intergenic
923593346 1:235339823-235339845 TAACATCCTAATTTTAGATAAGG - Intronic
923932157 1:238713573-238713595 GAAAATATTTATTTTAAATATGG - Intergenic
924223069 1:241898104-241898126 GACAATATTAATGTAAAATATGG + Intergenic
924341953 1:243045990-243046012 GTAGATATTAATTTTAGATATGG + Intergenic
1063236889 10:4126590-4126612 TAACATTTTATTTTTAAAAAGGG + Intergenic
1063586976 10:7361293-7361315 TAAAATATAAATTTTAAAAAGGG + Intronic
1063745307 10:8872766-8872788 GAACTTCTTAAGTTTAAATATGG - Intergenic
1063748500 10:8914717-8914739 AAAAATAGTAATTTTAAAAATGG - Intergenic
1064448648 10:15421010-15421032 GAACATTTGAAGTTTAAAAATGG - Intergenic
1064497490 10:15928070-15928092 TAACATACCAATATTAAATAGGG - Intergenic
1065034077 10:21620228-21620250 GAACATAAAAATTTTAAAAGAGG - Intronic
1065226900 10:23552803-23552825 GAATGTTTTAATTTTAAAAATGG - Intergenic
1065671245 10:28120471-28120493 AAACATAGTAATTTTAAAACTGG + Intronic
1065860137 10:29865602-29865624 GAATATATAAAGATTAAATAGGG - Intergenic
1066248601 10:33610385-33610407 ACAAATATTAATTTTTAATAAGG - Intergenic
1066605306 10:37160948-37160970 ACACATATTTATTTTAAAAATGG + Intronic
1066734529 10:38459549-38459571 GTAGATATTAATTTTAGATATGG - Intergenic
1067357299 10:45541806-45541828 GAACATATTATTTGAAAACATGG + Intronic
1067481722 10:46604659-46604681 GAACATACTAATTTAATAAAAGG + Intergenic
1067613029 10:47737068-47737090 GAACATACTAATTTAATAAAAGG - Intergenic
1069199629 10:65596844-65596866 GGAAATATTTATTTTATATATGG - Intergenic
1069261018 10:66397031-66397053 AAATATATGAATTTTAAATGAGG - Intronic
1069265746 10:66455320-66455342 GATCATATCACTTGTAAATAGGG - Intronic
1069281547 10:66660757-66660779 GTAGAGATCAATTTTAAATAGGG - Intronic
1069579285 10:69554523-69554545 GAAAATATTTATTTTAAAGCTGG + Intergenic
1071181671 10:82992190-82992212 TCACATCTTAATTTTTAATAAGG - Intergenic
1071382947 10:85087680-85087702 GAAGAAAATAATTTTAAATCAGG + Intergenic
1071465824 10:85938908-85938930 GAAGAAATTAACTTTAAAAAGGG - Intronic
1071604767 10:86978061-86978083 AAACATACTATTTTTAAATATGG - Intronic
1071628448 10:87197174-87197196 GAACATACTAATTTAATAAAAGG - Intergenic
1071727528 10:88214726-88214748 TGACATATTAATTTTTAAAAAGG - Intergenic
1072429718 10:95360088-95360110 GGACATATTTATTTTTAATTAGG - Intronic
1073277721 10:102326984-102327006 GAACATCTTAATCTTAAGGAGGG - Intronic
1073658303 10:105442834-105442856 ATACATTTTAATTTTATATAAGG + Intergenic
1073671437 10:105594661-105594683 GAAAATCTAAATTTTAAATTTGG - Intergenic
1073780152 10:106828775-106828797 GAAAATATTGTTTTTAAATGAGG - Intronic
1073967506 10:109008554-109008576 AAACATATTATTTAGAAATATGG + Intergenic
1074099233 10:110340941-110340963 AAGCAAATTAATTTTAGATAGGG - Intergenic
1074817508 10:117153752-117153774 GAAGAGATTAAGTTTAAATGAGG - Intergenic
1076127931 10:127990840-127990862 GAAAATTTTTATTTGAAATATGG + Intronic
1076269436 10:129138289-129138311 AAACATATTTATATTAAGTATGG + Intergenic
1076417593 10:130302068-130302090 GAACACATTACATTTATATATGG + Intergenic
1076968677 11:119540-119562 GTAGATATTAATTTTAGATATGG + Intergenic
1077742439 11:4861438-4861460 GAACATATTAGATTTTAAAAAGG - Intronic
1077763072 11:5124803-5124825 GCATTAATTAATTTTAAATAAGG - Intergenic
1078929630 11:15903246-15903268 CAACATATTATTTTTAATTTTGG - Intergenic
1078988371 11:16617195-16617217 GAACATATTATGTTTAAAATGGG + Intronic
1079436775 11:20462235-20462257 TAATATATTGATTTTATATATGG + Intronic
1079497082 11:21057143-21057165 AAACATGTAAATTTTAAAAATGG + Intronic
1079628231 11:22641754-22641776 TAACATATTAATTATAAGAATGG - Intronic
1079632952 11:22699951-22699973 GAGCATATTAATTTTCCATAGGG - Intronic
1079745473 11:24123199-24123221 GAATATCTTAATATTAAAAACGG - Intergenic
1080391724 11:31854362-31854384 GAATACATTATTTTCAAATATGG + Intronic
1080470845 11:32544253-32544275 GTACATATATATTTTAAACAAGG + Intergenic
1080507894 11:32935788-32935810 TAACATTTTATTATTAAATATGG + Intronic
1081164859 11:39795409-39795431 AAACATATTACTCTTGAATAGGG - Intergenic
1081185020 11:40031765-40031787 GAATATAATAAGTTTAAATCTGG + Intergenic
1081227751 11:40545632-40545654 GCACATATTAAGTATAAACAAGG + Intronic
1081350280 11:42043752-42043774 AAATAGATTATTTTTAAATAGGG + Intergenic
1081637467 11:44729963-44729985 CAACATATTCATTTTACAGACGG - Intronic
1081698468 11:45136307-45136329 GCACACATTAATTTTAAAATAGG - Intronic
1082019876 11:47523171-47523193 GAAGTTATAAATTTTAAAAAAGG + Intronic
1082045886 11:47726673-47726695 GCATAAATTAATATTAAATATGG - Intronic
1082183882 11:49155601-49155623 TAAAATATTACTTATAAATATGG + Intronic
1082183945 11:49156356-49156378 GGAGATACTAATTTTGAATAAGG + Intronic
1083009275 11:59380252-59380274 GAAAATAACAATTCTAAATAAGG - Intergenic
1084159486 11:67338338-67338360 AAATAAATTAATTTTAAAAATGG + Intronic
1084695153 11:70748578-70748600 GAAAATATTTATTTTAAAGGTGG - Intronic
1085198985 11:74690120-74690142 GAACATTTTAAATTTGAATTTGG + Intergenic
1085850993 11:80119884-80119906 GAAAAGAATTATTTTAAATAGGG + Intergenic
1085888978 11:80555136-80555158 GAAGATATTAATTCTAACCAAGG - Intergenic
1085958860 11:81435456-81435478 GGAAATATTAACTTTAAATAAGG + Intergenic
1086352614 11:85957956-85957978 GATCATATACCTTTTAAATAAGG - Intronic
1086604460 11:88679829-88679851 CAACAAATCGATTTTAAATAAGG + Intronic
1086682476 11:89689748-89689770 TAAAATATTACTTATAAATATGG - Intergenic
1086837228 11:91639811-91639833 GAACATCTTAACTTTATAGAAGG - Intergenic
1086841914 11:91696430-91696452 GTACATGTTTATTTTAATTATGG - Intergenic
1087005383 11:93465847-93465869 GAATATATATGTTTTAAATATGG - Intergenic
1087449156 11:98295785-98295807 GAATATATTACATTTATATATGG + Intergenic
1087980691 11:104609982-104610004 GAACAGTTTAAATTTAAATTGGG - Intergenic
1088516911 11:110646705-110646727 GAATAAATTATTTGTAAATATGG - Intronic
1088564655 11:111156765-111156787 AAACATTTTTATTTTAAAGAAGG - Intergenic
1088927831 11:114320196-114320218 GAAATTTCTAATTTTAAATACGG - Intergenic
1090979566 11:131706281-131706303 GGATATAACAATTTTAAATATGG + Intronic
1092738759 12:11608888-11608910 GAGAATAATAATTTTAAAAATGG + Intergenic
1093111146 12:15153829-15153851 AAAGATCTTATTTTTAAATAAGG - Intronic
1093294901 12:17377200-17377222 GGTCATTTTAAGTTTAAATAAGG + Intergenic
1093412366 12:18881971-18881993 AAAAATATTATTTTTCAATATGG + Intergenic
1093767088 12:22977027-22977049 TCACATATTAGTATTAAATAGGG + Intergenic
1093786873 12:23202360-23202382 AAACAAAATAATTCTAAATATGG + Intergenic
1093865418 12:24221322-24221344 AAACAAATTAATTTTAGAGATGG - Intergenic
1094151027 12:27283677-27283699 AAACATTTTATTTTTATATATGG + Intronic
1094685223 12:32705744-32705766 GCACATTTGAATTTTTAATAAGG + Intronic
1094690604 12:32764742-32764764 AAACAAGTTAATTTTAAAAATGG + Intergenic
1095132571 12:38561378-38561400 GAAAACATTTATTTTAAAAATGG + Intergenic
1095168108 12:38998677-38998699 GAACATATATTTTTAAAATATGG - Intergenic
1095318841 12:40800482-40800504 GAAAATATTATTTTTTAATAAGG - Intronic
1095829943 12:46574156-46574178 GAAAATTGTTATTTTAAATATGG - Intergenic
1095880827 12:47134461-47134483 GAAAATATTAACTTTAAACAGGG + Intronic
1096316335 12:50570137-50570159 GAACTTCTTCATTTTAAATCAGG - Intronic
1096569476 12:52513227-52513249 GATCCTATTAAATTTAAACAAGG + Intergenic
1097393150 12:59040302-59040324 GAAGTTATGAATTTTAACTAAGG + Intergenic
1097393395 12:59043231-59043253 GATAATATTAATATTAAACAGGG - Intergenic
1097418383 12:59343337-59343359 TAACATTTTAATTTTAAATGAGG + Intergenic
1097497745 12:60363332-60363354 GCAAATATAAATTTTAAAAAGGG - Intergenic
1097922666 12:65093020-65093042 GAGAATATTAACTTTAAATAAGG + Intronic
1098620244 12:72588249-72588271 GAAAAGAGTTATTTTAAATATGG + Intronic
1098626361 12:72675284-72675306 AAACATATCGATTTAAAATATGG - Intergenic
1099043936 12:77692758-77692780 AAACATATTTTTTTTAAAAAAGG - Intergenic
1099059939 12:77895276-77895298 GGACATTTTAATTTTAAAATAGG + Intronic
1099218019 12:79877193-79877215 ATACATAATAATTTTAAATATGG - Intronic
1100034064 12:90229468-90229490 GATCATATTTATTTTGAATATGG + Intergenic
1100686643 12:96993682-96993704 GATCATCTTAATTTGAAAAAAGG - Intergenic
1100694137 12:97072978-97073000 GATAATATTAATATTAGATAAGG - Intergenic
1100944660 12:99768099-99768121 AAACACATTAATTAAAAATATGG + Intronic
1102684108 12:114710828-114710850 GAACGTATTCTTTTTAAAAAAGG + Intergenic
1105063422 12:133174397-133174419 CAAAATATTGATTTTAAAGATGG + Intronic
1105309200 13:19191239-19191261 GAAAAAATAAATTTTAAAAATGG + Intergenic
1105501167 13:20973475-20973497 AATCATACTAATTTGAAATAAGG + Exonic
1105637623 13:22230724-22230746 GAACATATTTGTTTTAAATTTGG - Intergenic
1105637654 13:22231072-22231094 GAACAGATTTGTTTTAAATTTGG - Intergenic
1105753671 13:23445141-23445163 CCACATATTAATTTGAAATATGG - Intergenic
1106297162 13:28425532-28425554 GAACATAATATTTATAAATTTGG - Intronic
1107129146 13:36876842-36876864 TAAAATATTTACTTTAAATATGG + Intronic
1108374753 13:49803559-49803581 GGACATAGAAATTTGAAATAGGG - Intergenic
1108614950 13:52123664-52123686 GAACATATTACAGCTAAATAAGG + Intronic
1108965477 13:56293757-56293779 AAAAATAATAATTTTAACTATGG - Intergenic
1109038623 13:57300703-57300725 GAACCTATATATTTTAAAAAGGG - Intergenic
1109224323 13:59674199-59674221 GATCATATTACCTTTATATATGG + Intronic
1109447417 13:62460355-62460377 ATAGATATTAATTTTAAATAGGG - Intergenic
1109450160 13:62503118-62503140 GTACATATCAATTTCTAATATGG + Intergenic
1109510717 13:63368420-63368442 CAACATATTGTTTTTAATTATGG - Intergenic
1109531712 13:63658144-63658166 GAAGATATTATTTTTGAATAAGG - Intergenic
1109560360 13:64040483-64040505 CAAAGTATAAATTTTAAATATGG - Intergenic
1109774678 13:67024835-67024857 GAAAATGTTATTTTTAAATATGG - Intronic
1109924953 13:69124548-69124570 GGACATAATAATTGTAAATGTGG + Intergenic
1109984022 13:69951836-69951858 AGAAATATTGATTTTAAATATGG - Intronic
1110082487 13:71333290-71333312 AAAAGTATTAATTTTAAATTAGG - Intergenic
1110087685 13:71402984-71403006 GAAAATATTAATATTAAATGGGG - Intergenic
1110107643 13:71697816-71697838 GGCTATATTAATTTTAAAAATGG + Intronic
1110141432 13:72134915-72134937 GAAGTAATTAAGTTTAAATAGGG + Intergenic
1110466111 13:75803886-75803908 GAACTCAGTAATTTAAAATAAGG - Intronic
1110652245 13:77955299-77955321 GAACAATTTAATTTTTAAAAAGG - Intergenic
1110722209 13:78775804-78775826 GAACACAGTACTTTTAAATTTGG + Intergenic
1110929801 13:81200448-81200470 GACTATACTAATTTTAGATATGG - Intergenic
1111203298 13:84968275-84968297 TAACAGAATAATTTTAAACAAGG - Intergenic
1111218097 13:85170706-85170728 GAACAGATTAATATTACTTAGGG + Intergenic
1111224345 13:85249928-85249950 GAACATTTTTATTTTATATTTGG - Intergenic
1111501070 13:89120467-89120489 AAACATTTTAATTCAAAATATGG - Intergenic
1111508463 13:89228005-89228027 TCACGTAGTAATTTTAAATAGGG + Intergenic
1111540884 13:89665808-89665830 GAACATATAATTTTTAATAAAGG + Intergenic
1111736335 13:92144501-92144523 GAACAAATAATGTTTAAATATGG - Intronic
1111882731 13:93978381-93978403 GAACTTGTTCATTCTAAATAAGG + Intronic
1112160154 13:96858780-96858802 CAACATATTCATTTTACAGATGG - Intergenic
1112552816 13:100437637-100437659 AAACAAAGAAATTTTAAATATGG - Intronic
1113071794 13:106429013-106429035 ATAAATATTAATTTTAAACATGG + Intergenic
1114385356 14:22248809-22248831 AAACATATTATTTAGAAATATGG - Intergenic
1114390916 14:22307681-22307703 GAAAAAATGAATTTTAAAGAAGG + Intergenic
1114734582 14:25030808-25030830 CAACATGTTATTTTTAATTAAGG + Intronic
1114773871 14:25459285-25459307 TATCATATTTATTTTAAATGAGG + Intergenic
1115039233 14:28901478-28901500 TAAAATATTAATTTAAAAAATGG - Intergenic
1115833422 14:37369226-37369248 GAAGTAAATAATTTTAAATATGG + Intronic
1116159967 14:41255537-41255559 AAACATATTTATTTTTAAAAAGG - Intergenic
1116304009 14:43225876-43225898 CAATATATTATTTTTAAATTGGG + Intergenic
1116375813 14:44199222-44199244 AAACAAATTATTTATAAATATGG + Intergenic
1116547373 14:46185502-46185524 AAAGATAATAGTTTTAAATATGG - Intergenic
1116594046 14:46817692-46817714 GAATATATTACTTTTACATGAGG - Intergenic
1117412868 14:55466800-55466822 GATAATATTAAGTTTAAATGAGG - Intergenic
1118000386 14:61517760-61517782 TAAGATATTAATGTTAAAGAGGG + Intronic
1118207557 14:63737535-63737557 AAAAATATAAATCTTAAATACGG - Intergenic
1118412136 14:65491808-65491830 AAACAAGTTAATTTTATATAGGG + Intronic
1118871510 14:69746903-69746925 GCAAAAATTAATTTTAAAAATGG - Intronic
1119244326 14:73090522-73090544 GGACATGTTAATTATAAGTATGG - Intronic
1119581361 14:75784917-75784939 AAACATATGAATTTTAAAAAGGG - Intronic
1119741386 14:77015881-77015903 GAGTATTTTAATTTTAAAAAAGG - Intergenic
1120025160 14:79575356-79575378 AAACAAATTTATTTGAAATATGG + Intronic
1120080890 14:80215051-80215073 GAACATATGAAATCTAAACAAGG - Intronic
1120320421 14:82952669-82952691 GAACATTTTAGTTTAAAAAATGG - Intergenic
1120455488 14:84724636-84724658 TAATATATGAATTTTAAAAAAGG - Intergenic
1120482727 14:85072407-85072429 GAACATTTTCATTTTATTTACGG + Intergenic
1120487571 14:85133642-85133664 GAACAAATTAATAATGAATAAGG + Intergenic
1120638927 14:86986199-86986221 GAAAAAATAAATTATAAATACGG + Intergenic
1120800931 14:88687526-88687548 AAACATTTTACTTTTAGATAGGG + Intronic
1120925147 14:89790256-89790278 CATCTTTTTAATTTTAAATAAGG - Intergenic
1120984761 14:90324877-90324899 GCACATAGTGTTTTTAAATAAGG + Intronic
1122897137 14:104764513-104764535 GACTATCTTAATTTTAAAAAAGG + Intronic
1124354692 15:28986049-28986071 TACGATATTAATTTTAATTAAGG - Intronic
1124401912 15:29355903-29355925 TCACATTTTAATTTTACATAGGG - Intronic
1124857300 15:33401928-33401950 GTACATATTAATTTCAACAATGG + Intronic
1125349330 15:38751517-38751539 GAGCATATCAGTTTTAAACATGG + Intergenic
1126039456 15:44576188-44576210 GAAGATATTAATTTGATAAAGGG + Intronic
1126634519 15:50767736-50767758 GAACAAATGAATAATAAATAGGG + Intergenic
1127162964 15:56210179-56210201 TAACATATTAATTTCAGATAAGG + Intronic
1127180062 15:56405814-56405836 ATACATAATAATTTTAAAAATGG - Intronic
1129095842 15:73206780-73206802 CAACATTTTAATTTTAAGAATGG + Intronic
1129222885 15:74143430-74143452 TTACATTTTAATTTTAATTAAGG + Intergenic
1131503621 15:92996123-92996145 GATCATTTTAATTTGAAATTTGG + Intronic
1131880011 15:96852314-96852336 CAATATATTTATTTTTAATAAGG + Intergenic
1132088959 15:98932241-98932263 GAATAAATTAAGTTCAAATAAGG - Intronic
1132123106 15:99195244-99195266 AAACAAATTGATTTTAAAAATGG + Intronic
1132296641 15:100739933-100739955 GAACATATTAATGTTCATCAAGG - Intergenic
1134101472 16:11455360-11455382 GATTATATTATTTTTAAATATGG + Intronic
1135007545 16:18839975-18839997 GAAAAGATCAATTTTATATAAGG + Intronic
1135235871 16:20755201-20755223 TAAAATATAAAGTTTAAATAAGG + Intronic
1136345847 16:29675335-29675357 GAACTTTTTTATTTTTAATAGGG - Intronic
1136703664 16:32167234-32167256 GCACAGTTTAATATTAAATAGGG - Intergenic
1136763987 16:32759695-32759717 TTAAATATTAATTTTAAATTAGG - Intergenic
1136764043 16:32760368-32760390 GCACAGTTTAATATTAAATAGGG + Intergenic
1136804056 16:33110018-33110040 GCACAGTTTAATATTAAATAGGG - Intergenic
1136804112 16:33110691-33110713 TTAAATATTAATTTTAAATTAGG + Intergenic
1137448472 16:48548541-48548563 GAACCTATGAATTTTTAAAAAGG - Intronic
1138863725 16:60791540-60791562 GAATATTTTAATTTTAGGTATGG + Intergenic
1138913424 16:61431496-61431518 GAACAGATTATTTCAAAATATGG - Intergenic
1139068412 16:63348462-63348484 AAACATATTAAGATTAAAAAGGG - Intergenic
1139080609 16:63514642-63514664 GATGATATTAAATATAAATAGGG - Intergenic
1140150861 16:72363796-72363818 GAAGAGGTTAAATTTAAATATGG - Intergenic
1141960770 16:87406249-87406271 GAAAATAAAAATTTTAAAAAAGG - Exonic
1142451999 16:90179582-90179604 GTAGATATTAATTTTAGATATGG - Intergenic
1203066392 16_KI270728v1_random:1022494-1022516 GCACAGTTTAATATTAAATAGGG + Intergenic
1144878107 17:18412930-18412952 GAACATTTTAACTTTAACTGAGG - Intergenic
1145154123 17:20531495-20531517 GAACATTTTAACTTTAACTGAGG + Intergenic
1145721083 17:27073434-27073456 GAACATATTAATACCAAAAAAGG + Intergenic
1145851214 17:28099256-28099278 CAAAATCTTAATTTTAAAAAAGG - Intronic
1146131366 17:30279149-30279171 GATCCTATTAATTCTAAATCTGG + Intronic
1146198543 17:30834078-30834100 CAAAATATAAATTTTAAACATGG - Intronic
1146362897 17:32193266-32193288 GAAAATATTAAGTTTCAAAAGGG - Intronic
1146665700 17:34701627-34701649 GAACATATTAATATTATTTTTGG + Intergenic
1147031952 17:37645569-37645591 ATACATATTAATTTTATATATGG - Intergenic
1147643397 17:42018885-42018907 GAAAAAGTTAAATTTAAATATGG - Intronic
1149154848 17:53615671-53615693 GAACAGATTAAGGTTATATAGGG - Intergenic
1150901857 17:69287833-69287855 GAAAATAATAATTTGAAATGGGG - Intronic
1150939527 17:69675614-69675636 AAAGATATTTATTTTAAGTAAGG - Intergenic
1150972017 17:70039550-70039572 GACCAGATTAATAATAAATATGG + Intergenic
1152060825 17:78073769-78073791 TAATATATCAATATTAAATAAGG - Intronic
1152400391 17:80062891-80062913 CAATACATTAATTTTTAATATGG + Intronic
1152860346 17:82692700-82692722 GAACATTTTTTTTTTAAATCTGG + Intronic
1153197196 18:2613740-2613762 GAAGATCTTAATTTTAAGAAAGG - Intronic
1153460745 18:5330064-5330086 GAACATTTTAATATTTAACATGG + Intergenic
1153643851 18:7177454-7177476 GAAAATATTAATTATCAATTAGG + Intergenic
1153755595 18:8279957-8279979 CAACATATGAATTTAAAATGGGG - Intronic
1154026557 18:10713119-10713141 GAATATATATATTTTAAATTAGG + Intronic
1154104300 18:11506723-11506745 GGACATTGTAATTTTAAAAATGG - Intergenic
1155105028 18:22655578-22655600 GTTCATATTTATTTAAAATAGGG + Intergenic
1155109608 18:22700795-22700817 GATCAAATTAATTTTTATTAAGG - Intergenic
1155328349 18:24689000-24689022 GAAAATATTGACTTCAAATAAGG + Intergenic
1155447112 18:25923577-25923599 GAACATTGCAATTTTAAATCAGG - Intergenic
1155466088 18:26136976-26136998 GAAAAAAATAATTATAAATATGG - Intronic
1155773686 18:29731626-29731648 GAGCAAATAAATATTAAATAAGG + Intergenic
1155803163 18:30134463-30134485 AAACATATTAATCCTGAATATGG + Intergenic
1155905181 18:31442180-31442202 GAACATAAGAAATTAAAATAAGG - Intergenic
1156078725 18:33310723-33310745 GAAAATATTATTTTAACATAGGG - Intronic
1157133659 18:45032980-45033002 AAAAATTTTATTTTTAAATATGG - Intronic
1158006694 18:52680550-52680572 GAAGATATTAATCTCAATTAAGG - Intronic
1158049783 18:53202851-53202873 GAACATTTTATTTATAAAAAGGG + Intronic
1158170142 18:54588551-54588573 TTACTTATAAATTTTAAATATGG - Intronic
1158195226 18:54877427-54877449 GATCAAGTTAATTTCAAATATGG + Intronic
1158813753 18:61069557-61069579 GTAAAAATTAATTTTAAAAAGGG - Intergenic
1159035511 18:63273875-63273897 GATCAAATTAATATTAAAGAGGG + Intronic
1159326885 18:66932131-66932153 CAAAATATTATTTCTAAATAAGG + Intergenic
1159378326 18:67623671-67623693 GAACCTATTAAATTTTAATTTGG - Intergenic
1159389709 18:67774540-67774562 GAACACATGCTTTTTAAATAAGG - Intergenic
1159473424 18:68886133-68886155 GAATATATAAAATATAAATAAGG + Intronic
1159693020 18:71515297-71515319 GAAAAAATTAATTTGAAATCCGG + Intergenic
1159787415 18:72730656-72730678 GAATATATTAATTTACAAGAGGG + Intergenic
1159885837 18:73905253-73905275 TAAAATGTTAATATTAAATAGGG - Intergenic
1159996851 18:74972637-74972659 TAATACATTAATTTTAAATGTGG - Intronic
1160645486 19:189467-189489 GTAGATATTAATTTTAGATATGG + Intergenic
1162942482 19:14020024-14020046 CAACATATTAATTTATATTAAGG + Intergenic
1164290505 19:23864646-23864668 GAACATACTGATTTTAATTTTGG + Intergenic
1164734274 19:30529240-30529262 AAACATATTATATATAAATAAGG + Intronic
1165366477 19:35370540-35370562 GAAAATATTTATTTTAGATTCGG - Intergenic
1166419656 19:42626501-42626523 GAACATATGAATGTGAAATCCGG - Intronic
1166585984 19:43949395-43949417 AAACAGAATAAATTTAAATATGG - Intergenic
1166678732 19:44754736-44754758 CAACATTTTATTTTTAAATTTGG + Intronic
1168390852 19:56006725-56006747 AAAAATTTTTATTTTAAATACGG - Intronic
1168522666 19:57064921-57064943 GAACATTGTAATTTCTAATAAGG - Intergenic
925095952 2:1202861-1202883 AAACATAATAATTGTAAATATGG + Intronic
925507730 2:4587039-4587061 GAAAATGTTTATTATAAATATGG + Intergenic
925764769 2:7221541-7221563 TAACATATAACTTTTAAGTACGG - Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
926402177 2:12508815-12508837 GAACAGATTTTTTTTAAAAAGGG - Intergenic
926486681 2:13470285-13470307 GAACATTTTATCTTTAAATGAGG + Intergenic
926596964 2:14801517-14801539 GAACATATGAAATTGAAAAATGG - Intergenic
927052571 2:19345572-19345594 GAACATTATAATTAAAAATATGG + Intergenic
927229410 2:20806292-20806314 AAACATAATAATATTAAATGTGG + Intronic
927314813 2:21669476-21669498 GAACACATCAATTTTATACAAGG - Intergenic
928554257 2:32406738-32406760 TACCATTTAAATTTTAAATATGG - Intronic
929086229 2:38170070-38170092 GAACATATTAATTTTGCCTGTGG + Intergenic
930332355 2:50001633-50001655 TAACATTTAATTTTTAAATAAGG + Intronic
930372215 2:50516238-50516260 GAAATTCTTAATTTTGAATAAGG - Intronic
930413483 2:51058018-51058040 GAATATGTTTATTTTAAAAAAGG - Intergenic
930502517 2:52239580-52239602 CAATATCTTAATTTTAAAAAAGG - Intergenic
930524549 2:52511400-52511422 GAGCATAATAATTTTAAGGATGG + Intergenic
930660702 2:54050059-54050081 GAACCTATTGATGTTAAGTAAGG - Intronic
931545625 2:63382392-63382414 GAAATTATTAATTTCAAATGAGG - Intronic
931897815 2:66752586-66752608 GAAGATATAAAATTTAAACAAGG - Intergenic
932968292 2:76504798-76504820 GTAATTATTAATTTTAAAAATGG + Intergenic
934049282 2:88196995-88197017 GAACATATGAATTTTGGAGAGGG - Intergenic
934089514 2:88538981-88539003 ATACATATTAAAATTAAATATGG - Intergenic
934098624 2:88629834-88629856 GGAGGTTTTAATTTTAAATAAGG - Intergenic
936598838 2:113875815-113875837 AGACAGATTATTTTTAAATAAGG - Intergenic
937598865 2:123704776-123704798 GAATTTATTAATTTAAAATTTGG - Intergenic
937619994 2:123974167-123974189 AAACATATTAATATTAAAAGTGG + Intergenic
939297515 2:140288126-140288148 GAACATATACATTTAAAATTTGG + Intronic
939743060 2:145934414-145934436 GAACATAGAATTTTTTAATAGGG - Intergenic
939914645 2:148023653-148023675 GAAGAAATTAATTTTAGGTAAGG + Intronic
939978891 2:148754957-148754979 GAACGTATAAATGTAAAATAAGG + Intronic
940234992 2:151501343-151501365 GAAATTATTATTTTTTAATATGG + Intronic
940494672 2:154410885-154410907 GAATAAAGTAATTTTTAATATGG - Intronic
940518300 2:154709975-154709997 GTACATTTTAATTTTCAAAATGG - Intronic
940578359 2:155544396-155544418 TAACATATTTATTTTTAATAAGG + Intergenic
940588830 2:155693228-155693250 AAACAAATCAAATTTAAATAAGG - Intergenic
940811435 2:158247156-158247178 TTACATATTAATTTAAAAAATGG + Intronic
940828579 2:158441789-158441811 GAAGATATTAATATTAAATCTGG - Intronic
943044331 2:182840946-182840968 AAACATATCAATTTTATATCAGG - Intronic
943076197 2:183198218-183198240 GGAGATTGTAATTTTAAATAGGG - Intergenic
943094439 2:183411588-183411610 GAACATAATAAATTTAAGTTGGG + Intergenic
943164387 2:184300445-184300467 GTACATATTATATTTAGATATGG - Intergenic
943232576 2:185273958-185273980 GTCCTTATTAATTTTAAATAAGG - Intergenic
943267241 2:185748440-185748462 GAAAATATTAATAATAATTATGG - Intronic
943507002 2:188773459-188773481 GAAAATATTTATTTTAAGAAAGG + Intronic
943898165 2:193395102-193395124 GAAAATAGTAATGTTATATAAGG + Intergenic
944007387 2:194926566-194926588 GAACATGTTAACTACAAATAAGG + Intergenic
944016063 2:195039848-195039870 GAACATAGAAATTATGAATAGGG - Intergenic
944723585 2:202447814-202447836 TAAAATAACAATTTTAAATATGG - Intronic
944882072 2:204023478-204023500 CAATATATTAAGTTAAAATAAGG - Intergenic
944966013 2:204934655-204934677 GAACATTTTAATAATAAAAAAGG - Intronic
944968209 2:204960508-204960530 GAGCATCTTAAGATTAAATATGG + Intronic
945297554 2:208185696-208185718 GCACATCTCAATTTTACATAAGG + Intronic
945438118 2:209843218-209843240 ATACTAATTAATTTTAAATATGG - Intronic
945522148 2:210842218-210842240 AAATATATTAACTTTAAAAAAGG - Intergenic
945932350 2:215867533-215867555 GAAGACATGAATTTTAAAGACGG - Intergenic
947023568 2:225711463-225711485 GAAAAAATGAATTTTAAAAAAGG - Intergenic
947209095 2:227690405-227690427 GAATATAAAAATTGTAAATACGG + Intronic
949083425 2:242124140-242124162 GTAGATATTAATTTTAGATATGG - Intergenic
1169850671 20:10046580-10046602 GAAAATATTAATTATATTTAAGG + Intronic
1169906616 20:10611102-10611124 GAACATTTTAATTTGTAATGAGG - Intronic
1170313164 20:15014237-15014259 TAACATTTTAATTTTAAACTTGG - Intronic
1170566086 20:17606806-17606828 GAATATATGCATTTTAAATCTGG + Intronic
1171315189 20:24184709-24184731 GAAAGAATTAATTGTAAATAAGG + Intergenic
1173783596 20:45776054-45776076 AGACATATTCCTTTTAAATAAGG - Intronic
1173838920 20:46144346-46144368 CAACATAGTCATTTTAAAAAGGG - Intergenic
1176280019 20:64296764-64296786 GTAGATATTAATTTTAGATATGG - Intergenic
1176914194 21:14605170-14605192 GACCATATTAATTTTCAAATAGG + Intronic
1177016593 21:15796891-15796913 GAACATATTAATTATTATTATGG - Intronic
1177093064 21:16794319-16794341 TAACATATTTAATTTAAATAAGG - Intergenic
1177334972 21:19711719-19711741 AAAGAGAATAATTTTAAATATGG - Intergenic
1177455777 21:21336289-21336311 AAACATATTAAATGTTAATAGGG - Intronic
1178091617 21:29169511-29169533 GAGAATTTTACTTTTAAATAGGG - Intronic
1178293622 21:31389984-31390006 GAACATATCACTTTTCAGTATGG + Intronic
1179111133 21:38446328-38446350 GAAGATATTAATTGAAAGTAAGG - Intronic
1179283713 21:39957259-39957281 TAAAATAGTAATTTTAAAGAGGG + Intergenic
1179300279 21:40102088-40102110 AAACAGATTAATTTAAAATGAGG + Intronic
1180598304 22:16994605-16994627 GAACATATAAACTTAATATATGG - Intronic
1181159866 22:20953086-20953108 GAACATTTTATTTTTGAAAAGGG + Exonic
1181424938 22:22828711-22828733 GAATATATTAAGTGAAAATAAGG + Intronic
1183607410 22:38873827-38873849 GAACATACTGATTTTAAGTGAGG - Intergenic
1185076923 22:48688248-48688270 GAATGTATTAATTTTCAAGATGG - Intronic
1185085600 22:48739246-48739268 AAAAATATTTAATTTAAATATGG - Intronic
950330308 3:12150953-12150975 TATCATATTCATTTTACATATGG - Intronic
951516907 3:23570087-23570109 GAAGATATTAGATTTAAATCAGG - Intronic
951828051 3:26890378-26890400 GAGCAAATTGATTTTAAAGAAGG + Intergenic
951881946 3:27488126-27488148 AAAAAAATTAATTTGAAATATGG + Intergenic
952110081 3:30112565-30112587 TAAAATATTACTTTGAAATAAGG + Intergenic
953022410 3:39123457-39123479 CAACCTATTAGTTTGAAATAAGG - Intronic
953624447 3:44559174-44559196 GTACATAATAAGTTTAAGTAAGG - Intronic
953860543 3:46540668-46540690 GAACTTCTTAATTTTTAACAAGG - Intronic
954189330 3:48945405-48945427 GAACATACTAATTTTATATACGG - Intronic
955567331 3:60261372-60261394 GAACGTATTAATTTCAGAGACGG + Intronic
955772393 3:62398541-62398563 GAACAAAATAATTTAAATTATGG + Exonic
956251402 3:67237935-67237957 GAGGAGATTAATATTAAATAAGG - Intergenic
956330734 3:68104338-68104360 AAATATATAAATTTTAAATGTGG + Intronic
956539554 3:70320606-70320628 GAAGAAATCAATTCTAAATAAGG - Intergenic
957009921 3:74992436-74992458 ATACATATTAATTTTAAATTAGG + Intergenic
957310627 3:78513878-78513900 GAAAGTAATTATTTTAAATAGGG + Intergenic
957436559 3:80184813-80184835 AAATATATTCATATTAAATATGG + Intergenic
957849969 3:85795143-85795165 CAACATATTATTATTAATTATGG + Intronic
957912111 3:86633353-86633375 AAACATTTTAATGTTAAGTAAGG - Intergenic
957997890 3:87713685-87713707 TTAGATATTAATTTTAAAAAAGG + Intergenic
958052911 3:88370809-88370831 GAACTAATTAAATTTAAATGAGG + Intergenic
958432159 3:94053910-94053932 AAATATATTATTTTTAAATTAGG - Exonic
958524879 3:95243279-95243301 GAAAAAATTATTTTAAAATATGG + Intergenic
958538781 3:95440742-95440764 TAAAACATAAATTTTAAATACGG + Intergenic
958663790 3:97107133-97107155 TAATATTTTAATTTTATATATGG + Intronic
958894694 3:99816781-99816803 GAAGATATTATGTATAAATATGG - Intergenic
959177829 3:102939099-102939121 CAAAATATAAATTTAAAATATGG - Intergenic
959180651 3:102975483-102975505 GTACATAGTAATTTGAACTATGG - Intergenic
959401755 3:105911169-105911191 CGACATTTTAATTTTAAAGAAGG + Intergenic
959900635 3:111657671-111657693 GAACATATAAATATGGAATAAGG + Intronic
960026377 3:113015418-113015440 GAAGATTGCAATTTTAAATAGGG + Intronic
960080898 3:113539268-113539290 GAACAATTTAAACTTAAATAAGG - Intronic
960365762 3:116770450-116770472 GAGCATATTAATGGTCAATACGG - Intronic
960483248 3:118219161-118219183 GAAAAGATGAATTTTAACTACGG + Intergenic
962890412 3:139667287-139667309 GATAATAGTCATTTTAAATAGGG + Intronic
962909177 3:139832183-139832205 GAAAATATTCATCTTAAATGAGG + Intergenic
962922351 3:139961891-139961913 TAAGATATAAATTGTAAATATGG - Intronic
963541299 3:146593046-146593068 GAAAATATTAATATGAAAGATGG - Intronic
963981894 3:151547081-151547103 AAACATATTATTTAGAAATATGG - Intergenic
964041568 3:152268143-152268165 TAACATATTATTTTTAAAGAGGG + Exonic
964235177 3:154517527-154517549 GACCATATTAATTGTCTATAAGG + Intergenic
964338477 3:155683143-155683165 GAACATAGCAAAATTAAATATGG - Intronic
964778684 3:160310833-160310855 GAACATATTAATTGTAATCAAGG + Intronic
964891607 3:161543142-161543164 GAACATAAAAATATTAATTAGGG - Intergenic
964906995 3:161728975-161728997 AAATATAATAATTTTAAATAGGG - Intergenic
965096432 3:164233600-164233622 ACATATAATAATTTTAAATAAGG - Intergenic
965136027 3:164769634-164769656 GACCACATTAACTTTAAGTAAGG - Intergenic
965281281 3:166756857-166756879 GATCATATTAAGTTTGAATGTGG - Intergenic
965440714 3:168710222-168710244 GAAAATATTTATATTAAAAAAGG + Intergenic
965474169 3:169133191-169133213 GAAGATATTACTGTTAACTATGG + Intronic
965478502 3:169186870-169186892 GCAGATATTATTTGTAAATAGGG + Intronic
965875255 3:173309855-173309877 GAACATATTAACTTTTGAGATGG + Intergenic
965914835 3:173831044-173831066 GAAAATATTATTTTTAAAGGGGG - Intronic
966220702 3:177548411-177548433 GAACATGTCTATTTTGAATAGGG - Intergenic
967467214 3:189821787-189821809 GGACATTTTCATTTTAAATCAGG - Intronic
968197380 3:196718991-196719013 GCAAATATTAATAATAAATATGG - Intronic
968294370 3:197562533-197562555 GAAAAATTTAATTTTAAAAATGG + Intronic
968372197 3:198230059-198230081 GTAGATATTAATTTTAGATATGG - Intergenic
969385008 4:6838626-6838648 TAACAGATTTATTTTAAATGTGG - Intronic
969404977 4:6985394-6985416 GATCATTTTAATTTTAAAAAAGG - Intronic
969932953 4:10650026-10650048 GTACATATTATGTTTAACTAAGG + Intronic
970761463 4:19494184-19494206 GAAGATAATAATTTTAGTTAAGG - Intergenic
971118253 4:23674009-23674031 TAACATATTAATCTTACTTAAGG + Intergenic
971781476 4:31040501-31040523 CAACATATTAGTTTGAACTAAGG - Intronic
971823028 4:31584370-31584392 TAACATATTAAGTTCTAATAAGG - Intergenic
971837280 4:31783951-31783973 GTACAAATTACTTTTAAATAAGG + Intergenic
971872178 4:32256524-32256546 CAACATATAAATATAAAATATGG - Intergenic
972270360 4:37504848-37504870 GATCATATTATCTTCAAATAAGG + Intronic
972908957 4:43789179-43789201 GAACATATTAGTTCAAATTATGG - Intergenic
973087247 4:46080719-46080741 GAATATATTAAATAAAAATATGG - Intronic
973883209 4:55294622-55294644 GAAAATAAAAATATTAAATATGG + Intergenic
974416209 4:61610108-61610130 GAGCATTTTAGTTTAAAATAAGG + Intronic
974417359 4:61627207-61627229 GAAAAGACAAATTTTAAATAAGG - Intronic
974478505 4:62414969-62414991 GAAAATATTATTTTAAAACAGGG - Intergenic
974788376 4:66652542-66652564 TAACATTTTGATTTTAAAAAGGG + Intergenic
974824171 4:67105291-67105313 GAAGATGTAAATTTTAAATGAGG - Intergenic
974860333 4:67512695-67512717 GAACATGTGACTTTTAAAAATGG - Intronic
974899809 4:67983278-67983300 GATCATGTTAATATTAAAAAAGG - Intergenic
975020962 4:69487898-69487920 GAATAAATTAATATTAAATTTGG - Intronic
976103194 4:81587708-81587730 GAAAATATTAGTTACAAATATGG - Intronic
976600479 4:86934111-86934133 CATCATATTAAATTTAAGTAAGG + Intronic
977147525 4:93463575-93463597 TAAAATAGTAATTTTAATTATGG - Intronic
977282146 4:95054071-95054093 AAAGACATTTATTTTAAATATGG - Intronic
977726577 4:100303313-100303335 AAACAAATGAATTTTAAAAAGGG - Intergenic
977749278 4:100589327-100589349 GAAGAAACTAGTTTTAAATAGGG - Intronic
977878330 4:102175539-102175561 CAACATATCAATATTAAGTAAGG - Intergenic
978214022 4:106175659-106175681 GACCATTTTAATGGTAAATATGG - Intronic
978254516 4:106678455-106678477 GAACATATTCCTCTCAAATAAGG - Intergenic
978539294 4:109799379-109799401 AAACACATTATTTTTGAATAAGG + Intronic
979078149 4:116300529-116300551 GTACATGTAAATTTGAAATAAGG - Intergenic
979260880 4:118642539-118642561 GTAGATATTAATTTTAGATATGG - Intergenic
979311732 4:119211773-119211795 GAACATACTAATTGTAAAAATGG - Intronic
979377004 4:119958375-119958397 AAAGATATTATTTTAAAATAAGG - Intergenic
979676638 4:123416480-123416502 GAAAAGATTAATTTTTAATATGG - Intergenic
980093991 4:128470987-128471009 GAACATATAAAGTATAGATACGG - Intergenic
980295251 4:130906306-130906328 AAACAAATTAATTTAAAAAAAGG - Intergenic
980319372 4:131249222-131249244 GAACCAATTAGTTTTAAAAAGGG - Intergenic
980418541 4:132526386-132526408 GAAAATATTGAATTTAATTAAGG - Intergenic
981041446 4:140226277-140226299 TAACATATGAATTTGAAATCTGG + Intergenic
981291094 4:143076442-143076464 GAACATTTTATTTTAAAATCAGG - Intergenic
981866136 4:149421442-149421464 GACCATATTTATTTTATTTATGG - Intergenic
981911933 4:149992022-149992044 GAACATATTATTTGGAGATATGG - Intergenic
982459059 4:155645225-155645247 TAACAAATTATTTTTAATTAAGG + Intergenic
982467939 4:155753640-155753662 GGACATATTACATTTATATAAGG + Intergenic
982655625 4:158145643-158145665 TAAAATATTACTTTTAATTATGG + Intronic
982744084 4:159088172-159088194 GAACATGTTAATTTTGCATTTGG + Intergenic
982781402 4:159494913-159494935 GATGATATTAATTTTTAATATGG + Intergenic
982900690 4:160998483-160998505 AATCATATATATTTTAAATATGG + Intergenic
982926325 4:161341095-161341117 TAAATTATTTATTTTAAATATGG + Intergenic
982986806 4:162219463-162219485 CCACATATTAATATTAAATATGG - Intergenic
983060553 4:163154490-163154512 GTATATATTAATTTTGAAAAAGG + Intronic
983200603 4:164856796-164856818 AAACATTTTAATTTAAAACATGG - Intergenic
983804487 4:171977302-171977324 GAAAGTATAAATGTTAAATAAGG + Intronic
984156465 4:176201082-176201104 AAACATATGAATTGAAAATATGG + Intergenic
984185008 4:176533089-176533111 AAACACCTTAATTTTAAATTGGG + Intergenic
984277754 4:177630137-177630159 GAACAAATTAATTCTAAAATAGG - Intergenic
984286307 4:177733682-177733704 TCTCATATTAATTTTAAAAAGGG - Intronic
984472350 4:180192619-180192641 GAACAAATATCTTTTAAATATGG + Intergenic
986026197 5:3853656-3853678 GCACATATTAATTTACAACAGGG + Intergenic
986472793 5:8092699-8092721 GAACATATGAATTTTCAAGATGG - Intergenic
987239429 5:15979213-15979235 AAAAATAGTAATTTTAAAAATGG + Intergenic
987645163 5:20661256-20661278 GCCCATATTTATTTTATATATGG - Intergenic
987853063 5:23381838-23381860 GAAGATATTCAGTTTCAATAAGG - Intergenic
988116789 5:26903901-26903923 AAATACATTAATTTTAAATAGGG + Intronic
988310120 5:29546118-29546140 ATATATATTAATTTGAAATAAGG - Intergenic
988329557 5:29817947-29817969 AAACATATTACTTGTATATATGG + Intergenic
988354697 5:30158536-30158558 GAAGTTATTAATTGTAATTAGGG - Intergenic
988643723 5:33070224-33070246 GAAAATATAAATTTATAATAGGG + Intergenic
988916200 5:35895726-35895748 GAACTTATTTATTTTAATTTTGG - Intergenic
989115464 5:37948452-37948474 GAACAAACTCATTTGAAATATGG + Intergenic
989548412 5:42701969-42701991 CAACATATTTTTTTGAAATATGG + Intronic
989756763 5:44964903-44964925 TAACATATTGATATTAAAAAAGG - Intergenic
990027350 5:51210367-51210389 GAACATTTTAATTCTATTTATGG + Intergenic
990458148 5:56008732-56008754 GAAAAAATTAATTAGAAATATGG + Intergenic
990754252 5:59050919-59050941 AAATAAGTTAATTTTAAATAAGG + Intronic
990964651 5:61432023-61432045 GAAGACATGAATTTTAAAAATGG - Intronic
991336608 5:65555199-65555221 GGACAATATAATTTTAAATAAGG + Intronic
991572450 5:68069561-68069583 GAACATGATATTTTTAAAAAGGG - Intergenic
991576829 5:68113302-68113324 GAACATATTTTGTTTAAATCTGG - Intergenic
992247006 5:74836290-74836312 TAACATAATAAAATTAAATAGGG - Intronic
992556764 5:77911564-77911586 GAAATTAGTAATTTTAAGTAAGG + Intergenic
992912472 5:81410329-81410351 GAGCATTTTAATTTTGAATTTGG + Intergenic
992956447 5:81914288-81914310 GATCATATTAAATAAAAATATGG - Intergenic
993214455 5:85001806-85001828 AAACATTTGAATTTTAAATAGGG + Intergenic
993265380 5:85720683-85720705 GAAGACATTTATTGTAAATAAGG - Intergenic
993415253 5:87620718-87620740 GAACATATTAAGTATATATGAGG - Intergenic
993968291 5:94385737-94385759 TAACAAATTCATTTTAAATTTGG + Intronic
994937898 5:106279543-106279565 GAAAATATAAGTTTTAAATCTGG - Intergenic
995089526 5:108157014-108157036 GAAATTCTTATTTTTAAATATGG - Intronic
995104453 5:108358852-108358874 GAATATATTTATAATAAATAAGG - Intronic
995271872 5:110228736-110228758 TAAAATATTGATTTTAAAGAAGG + Intergenic
995323102 5:110859388-110859410 GAACATATTCATGTTAGAGAGGG - Intergenic
995402039 5:111753909-111753931 GCACATATTAATGTAAAAAAAGG - Intronic
995616321 5:113968379-113968401 GTAATTATTCATTTTAAATAGGG - Intergenic
996034948 5:118748565-118748587 GTACAAACTAATTTTAAAAAGGG - Intergenic
996139143 5:119884114-119884136 GAAAATTTTACTTTTAAAAATGG + Intergenic
996690474 5:126334784-126334806 AAAAATTTTAATTTAAAATAAGG - Intergenic
996867946 5:128150480-128150502 TAAAATTTTAATTTTAAAAAAGG + Intronic
997298065 5:132781903-132781925 CAAAATATTAATGATAAATAAGG - Intronic
997790375 5:136754255-136754277 GAAAATTTTAACTATAAATAAGG + Intergenic
997927184 5:138041520-138041542 GAAGATCTTAATTTTAAAAATGG + Intronic
998269321 5:140692586-140692608 AAAAATAATAATTTTTAATAAGG - Intronic
998274478 5:140739339-140739361 AATCATATTAACTCTAAATAAGG + Intergenic
998343990 5:141444589-141444611 GCAAAAATCAATTTTAAATAAGG - Intronic
999045487 5:148464404-148464426 GAACAACCTAATTTTAAAAATGG + Intronic
999345450 5:150815080-150815102 GAACAAATAAACTATAAATATGG + Intergenic
999898267 5:156058644-156058666 GGAAATATGAATGTTAAATATGG + Intronic
1000431157 5:161154110-161154132 TAACATATTAACTTTAGAAAGGG - Intergenic
1000583709 5:163067501-163067523 TAACATATTTATGTTACATAAGG - Intergenic
1000990542 5:167907387-167907409 GAACATTGTCATTTTAAATGTGG + Intronic
1002731438 5:181335609-181335631 GTAGATATTAATTTTAGATATGG - Intergenic
1002753102 6:138481-138503 GTAGATATTAATTTTAGATATGG + Intergenic
1004585397 6:16994766-16994788 GAACTTATTAAATTTACTTAGGG + Intergenic
1005559971 6:27029804-27029826 CAAAATATTTATATTAAATATGG - Intergenic
1005897816 6:30192760-30192782 GAAAATATTAATGCTAATTAGGG + Intronic
1006207109 6:32356994-32357016 GAAGATATTAATATTAGGTAAGG - Intronic
1006529283 6:34636788-34636810 GAACATGTTTCTTATAAATAAGG - Intronic
1007437869 6:41829943-41829965 CAACATATTAATTTTTAAAAGGG - Intronic
1007916405 6:45565574-45565596 CTACATTTTAATTTTAAAAATGG - Intronic
1008234177 6:49024561-49024583 TCACATATTAATATTAAATTTGG - Intergenic
1008319985 6:50099427-50099449 GAATAAATTATTATTAAATAAGG - Intergenic
1008323832 6:50151919-50151941 AAATATATTTATTTTAAAAATGG - Intergenic
1008741760 6:54616785-54616807 AAACATATTAACTTTGAAAATGG + Intergenic
1008781008 6:55104972-55104994 GAAACTATCATTTTTAAATATGG - Intergenic
1009276130 6:61682907-61682929 GTAAATATTCATTTTACATAAGG - Intronic
1009472163 6:64041019-64041041 TTACATTTTAATTTTAAACATGG + Intronic
1009483023 6:64184047-64184069 GAAGATTTTTATTTTAAATGAGG - Intronic
1009662137 6:66627775-66627797 AAAAATATTAATTTAAAATAAGG - Intergenic
1009871926 6:69463529-69463551 CAATATATTATTTTTAAATGTGG + Intergenic
1010061583 6:71628608-71628630 CAATATATTATTTTTAATTATGG + Intergenic
1010536230 6:77034852-77034874 GAATAATTTAATTTTAAAAAGGG + Intergenic
1010739873 6:79488316-79488338 GAACATTCTATTTTTAAAAATGG + Intronic
1010908578 6:81523813-81523835 AATAATATTGATTTTAAATATGG - Intronic
1011103180 6:83747268-83747290 GAAGATTTTAAGTTTAATTAAGG - Intergenic
1011150294 6:84264873-84264895 GAAAATATTCTTTTTAAAAAGGG - Intergenic
1011205705 6:84894397-84894419 GAACATACTAGTTCCAAATAGGG - Intergenic
1011385177 6:86788748-86788770 GGACATGTTACTTTAAAATATGG - Intergenic
1011812995 6:91154691-91154713 GACCATCTTAACTTTAAAAAAGG + Intergenic
1011870117 6:91882373-91882395 TAACATAGTAATTTAGAATAGGG - Intergenic
1011992200 6:93535940-93535962 GAACATAAAAGTTTTAAAAAAGG - Intergenic
1012103954 6:95128853-95128875 GAAAATATCAATTTTTCATAGGG + Intergenic
1012114612 6:95280237-95280259 TAAAATATAAATTTTAAATATGG + Intergenic
1012573144 6:100757089-100757111 GAACATTTTAATTTTGAAATTGG - Intronic
1012669558 6:102025447-102025469 GAGGGTTTTAATTTTAAATAGGG + Intronic
1012749339 6:103138190-103138212 GTAAATATTAATTTTATAGAAGG + Intergenic
1012790192 6:103683621-103683643 AAAAATATTAATTTGAAAAATGG + Intergenic
1013319172 6:108970230-108970252 AACCATATTAATTCTAAATTGGG - Intronic
1013917542 6:115359776-115359798 GAAAATATTCACTTTAAATAAGG - Intergenic
1013954779 6:115828630-115828652 TAAGAAAATAATTTTAAATATGG - Intergenic
1013977962 6:116098529-116098551 GAAGTAATTAATGTTAAATAAGG - Intergenic
1014007144 6:116432463-116432485 GAAAATATCATTTTAAAATAAGG + Intronic
1014152710 6:118076878-118076900 TACCATATTTATTTTATATAGGG + Intronic
1014575170 6:123060433-123060455 GAATATATTATTATTGAATAAGG + Intronic
1014897308 6:126918218-126918240 AAATATATTATTTTTAACTAAGG + Intergenic
1015060461 6:128958853-128958875 AAATATATTATTTTTAAATCCGG - Intronic
1015238701 6:130999741-130999763 AATCATATTAATTTTAGATCTGG + Intronic
1015330249 6:131969604-131969626 GAACATAATTATTTTTAATTTGG - Intergenic
1015492377 6:133840079-133840101 AAAGATTTTATTTTTAAATAAGG + Intergenic
1015649081 6:135434100-135434122 GAACATATTAATTTTAAATATGG + Intronic
1016097610 6:140057531-140057553 GAACATATTTGTTTAAATTAAGG - Intergenic
1016563716 6:145427279-145427301 GAAGATAGCCATTTTAAATAGGG + Intergenic
1017582833 6:155885954-155885976 GAAAATATTTACTTTAACTATGG - Intergenic
1018069247 6:160147518-160147540 AAACATCTGAATTTTAAATAAGG + Intronic
1019827420 7:3296021-3296043 AAACAAATAAATTTTAACTATGG + Intergenic
1020239465 7:6381743-6381765 GAACATCATAATTTTAGATTGGG + Intronic
1020589393 7:10115226-10115248 GAACTCATTCATTTAAAATAAGG - Intergenic
1020669164 7:11084618-11084640 GAAAAAATAAATTTTCAATAGGG - Intronic
1020849194 7:13328752-13328774 AAACATATTATTTATAAATCAGG - Intergenic
1021008125 7:15425854-15425876 GAACATAGCAATTTTAAAGGTGG + Intronic
1021201370 7:17731740-17731762 TAACATATACATTTTAAAAAAGG - Intergenic
1021315973 7:19147341-19147363 TAACATATTAATTTAAACGAGGG - Intergenic
1021369787 7:19829726-19829748 GAGCAAATTCTTTTTAAATATGG + Intergenic
1021768278 7:23970758-23970780 TTACATGTTAATTTTACATATGG + Intergenic
1023309996 7:38876586-38876608 AAACATATTTATTATAAAAACGG + Intronic
1024076586 7:45822785-45822807 GTAGATATTAATTTTAGATATGG - Intergenic
1024106618 7:46094636-46094658 GAATATTTTAATGTTAACTAAGG - Intergenic
1024313938 7:47995947-47995969 GAAAATGTTAATTTTAAAAATGG - Intronic
1024818482 7:53298987-53299009 GAATATATTAATTTTCAAAGTGG + Intergenic
1025059613 7:55794230-55794252 GTAGATGTTATTTTTAAATATGG + Exonic
1025127832 7:56358643-56358665 GTAGATATTAATTTTAGATATGG + Intergenic
1025615863 7:63115791-63115813 GTAGATATTATTTTTAGATATGG + Intergenic
1025973707 7:66352876-66352898 GAACATTTTTATTTCAAATTAGG - Intronic
1027051200 7:75022179-75022201 CAACATATTAAATTTCAAGAGGG - Intronic
1027561419 7:79735980-79736002 GGACATATTACTCTAAAATATGG + Intergenic
1027564381 7:79772865-79772887 GAAGAAATTAATTTTATATTAGG - Intergenic
1028960797 7:96748098-96748120 GACCACATTAAATTTTAATAGGG - Intergenic
1028993733 7:97077032-97077054 TAAAATTTTAATTTTAAAAAAGG - Intergenic
1029508256 7:100975984-100976006 TATCATATTAATATTAAAAATGG + Intronic
1029700790 7:102245606-102245628 GAAGTTATTAAGATTAAATAAGG - Intronic
1030196039 7:106854786-106854808 GAACATATTAAATTGGACTATGG + Intergenic
1030869176 7:114734173-114734195 GAGCTTATTAAGTTAAAATAAGG - Intergenic
1030947759 7:115746599-115746621 AAAATTATTAATTTTAAAAATGG - Intergenic
1031197216 7:118630717-118630739 AAATATTTTAATTCTAAATAAGG - Intergenic
1031312991 7:120222555-120222577 GAACATAATTATTTCAAAGAGGG + Intergenic
1031768382 7:125809964-125809986 TGATATATTAATATTAAATAAGG + Intergenic
1032147011 7:129393108-129393130 AAACATATTAATTATAAACTGGG - Intronic
1032999308 7:137485500-137485522 GAGCATAGTAATATTAAATTGGG - Intronic
1033397020 7:140985087-140985109 AAATATATTAGTTATAAATAGGG + Intergenic
1034388117 7:150757830-150757852 AAACCTATTAATTTTAAAAAGGG + Intergenic
1034518924 7:151603859-151603881 GTACATAATTATTTTAAACAAGG - Intronic
1034756148 7:153622300-153622322 AAATAAATTAATTTTAAAAAAGG - Intergenic
1035123033 7:156584862-156584884 GCAAAAATTAATTTTAAAAATGG + Intergenic
1035189855 7:157156948-157156970 GAAGACATTAACTATAAATAAGG - Intronic
1035512076 8:198673-198695 GTAGATATTAATTTTAGATATGG + Intronic
1035853941 8:2952695-2952717 GAGCATATAAATTCTAATTAGGG - Intronic
1036026073 8:4910651-4910673 TAACATATTAATTTTGAAGGGGG + Intronic
1036040368 8:5072921-5072943 CAACTTATTACTTTTAAAGAGGG + Intergenic
1036293504 8:7516897-7516919 GAACACATTAAATATAAAGATGG + Intergenic
1036329055 8:7804098-7804120 GAACACATTAAATATAAAGATGG - Intergenic
1036724592 8:11208497-11208519 AAACATTTTTATTTTAAAAAAGG - Intergenic
1036783314 8:11666037-11666059 GAAAATATCAATGTTCAATAGGG - Intergenic
1037277552 8:17197464-17197486 AAGCATATGAAATTTAAATATGG - Intronic
1037283894 8:17275111-17275133 ACAAATAATAATTTTAAATATGG + Intronic
1038835841 8:31121919-31121941 GTACATGTTACTATTAAATATGG + Intronic
1039119233 8:34127230-34127252 GAACATTTCAATTTTAGATCTGG - Intergenic
1039147104 8:34460519-34460541 GAATTTCTTAATTGTAAATATGG + Intergenic
1039630320 8:39105160-39105182 GAACAGATTAGTTTTGAAGAAGG + Intergenic
1041178220 8:55220008-55220030 CAATATATTATTTTTAACTATGG - Intronic
1041400273 8:57435533-57435555 GTGCAAATTATTTTTAAATATGG - Intergenic
1041555794 8:59153845-59153867 GAAAATTTTAATTTTAATGAAGG + Intergenic
1041558992 8:59192881-59192903 AAAAATGTTAATTTTAACTATGG + Intergenic
1041694375 8:60720327-60720349 GACTATGTTCATTTTAAATATGG + Intronic
1041711976 8:60902742-60902764 GCACATAATAATTTTAGCTATGG + Intergenic
1043012190 8:74894675-74894697 GAACATATTCCTTGTAGATAAGG - Intergenic
1043464802 8:80494065-80494087 GAACAAATTCATTTTATAGAAGG - Intronic
1043504813 8:80891846-80891868 GAACATTGTAAATGTAAATAAGG - Intergenic
1043688658 8:83122310-83122332 AAAAATTTTAATTTTATATAAGG - Intergenic
1044259387 8:90099617-90099639 AAGCATATTTATTTTATATATGG + Intergenic
1044299115 8:90563373-90563395 GAACATAATAGTTCTAAAAATGG - Intergenic
1044418106 8:91959243-91959265 GAAAAAAATAATTTTAAAAATGG - Intronic
1044657398 8:94562965-94562987 AAACCTATTAATTTTTAAAAAGG + Intergenic
1044693956 8:94904480-94904502 GAACAAATTATTTTAAAACATGG - Intronic
1045317769 8:101058159-101058181 GATCATATAAATATTGAATAAGG + Intergenic
1045609383 8:103818068-103818090 GAACATCTTATTTTAAAAAATGG + Intronic
1046193327 8:110828132-110828154 GAACATATATATTTAAAATAAGG + Intergenic
1046240298 8:111481694-111481716 GAAAATATGAATTATAAAGAAGG + Intergenic
1046465272 8:114593863-114593885 GAATATATGAATTTACAATAAGG + Intergenic
1046478692 8:114784382-114784404 GAAGATATTTATTCCAAATAAGG - Intergenic
1046597606 8:116279719-116279741 GAATTTTTAAATTTTAAATAAGG - Intergenic
1046923570 8:119762379-119762401 GAACATATAACTTTAAAGTAAGG + Intronic
1047786084 8:128154963-128154985 CAACATCTTAATTGTAAAGAGGG + Intergenic
1048108509 8:131440164-131440186 GAAAAAATCAATTTTAAATAAGG + Intergenic
1048411047 8:134173195-134173217 GGACATATTAATGTTAGATTTGG + Intergenic
1049565854 8:143338575-143338597 AAAAATGTTAATTTTAAAAAGGG + Intronic
1049903891 9:197724-197746 GAACAGATTTTTTTTAAATGTGG - Intergenic
1050272997 9:3966137-3966159 GAACATATCAGTTTCCAATAAGG - Intronic
1050524712 9:6535593-6535615 AAACATGTTAATTTTACATCTGG - Intronic
1050991551 9:12160768-12160790 GCACATAATAATTTATAATAAGG + Intergenic
1051169453 9:14304861-14304883 GAATATATAAATTTTGAAAAGGG + Intronic
1051941575 9:22512024-22512046 AAATATAAAAATTTTAAATATGG + Intergenic
1051975944 9:22949229-22949251 GAAAGTATTATTTTTACATAAGG - Intergenic
1052058702 9:23933272-23933294 GAACATTTTAATTCAAATTATGG - Intergenic
1052157417 9:25209935-25209957 GAAGATCTTAATGTTGAATATGG - Intergenic
1052223962 9:26061479-26061501 GAATATATTTATTTAAAAAAAGG - Intergenic
1052588722 9:30463111-30463133 GAACATACTCATTTTGTATAAGG - Intergenic
1052641531 9:31172641-31172663 GAAAAAACTAATTTTATATATGG - Intergenic
1052665132 9:31486679-31486701 CAACATAGTTATTTTAAATGAGG - Intergenic
1053228856 9:36387689-36387711 TAAGATTCTAATTTTAAATATGG + Intronic
1055081556 9:72272518-72272540 GAACATATTAAAGTTAACTTAGG + Intergenic
1055344078 9:75315517-75315539 TAACATAGTAATGTTAAGTAAGG - Intergenic
1055812664 9:80167778-80167800 CAATAAATTATTTTTAAATAAGG - Intergenic
1056413099 9:86351521-86351543 GCACTTATTAATATTAAATGGGG - Intronic
1057157515 9:92856491-92856513 GAACAAAATAATTTTAAAAATGG + Intronic
1057306467 9:93915152-93915174 GAACATTTGTATTTTTAATAGGG + Intergenic
1057453758 9:95189202-95189224 GGACATATAAATTTTAAAAAGGG - Intronic
1058369199 9:104245585-104245607 GAAAATGTAAATTTTACATATGG + Intergenic
1058489931 9:105487305-105487327 GTACATTTTTATTTTAAATTTGG + Intronic
1058573296 9:106371396-106371418 GAGAATATTATTTTCAAATAAGG + Intergenic
1059511912 9:114856305-114856327 TAACACATGAATTTTAAATTTGG + Intergenic
1060456685 9:123805166-123805188 GAAAATTATAAATTTAAATAAGG - Intronic
1062456591 9:136642412-136642434 GAGCATATTATTTCAAAATAGGG - Intergenic
1062755843 9:138288113-138288135 GTAGATATTAATTTTAGATATGG - Intergenic
1203779710 EBV:94657-94679 GAACATATTGAGGTGAAATAAGG - Intergenic
1203454502 Un_GL000219v1:152475-152497 GAAAAAATTAATTTAAAAAAAGG - Intergenic
1186270601 X:7883065-7883087 AAACATATTAATCTTAAGTTGGG - Intergenic
1186326062 X:8477885-8477907 GAAGATATCATTTTTAAATGAGG - Intergenic
1186533611 X:10324054-10324076 AAACATAGTTATTATAAATATGG + Intergenic
1187080431 X:15980650-15980672 GAACATTTTAATGTTTAATAGGG + Intergenic
1187184682 X:16971917-16971939 AAACATTTTAATTTTAGATCAGG - Intronic
1188154880 X:26729378-26729400 GAATATATTAATGTAAACTATGG - Intergenic
1188252580 X:27915853-27915875 CAACATATTAATGTCAAAAAAGG - Intergenic
1188504406 X:30866158-30866180 AAACATTTTCAATTTAAATATGG + Intronic
1188511049 X:30936877-30936899 GAAAATATGAATTTTCAATTTGG + Intronic
1188613939 X:32134073-32134095 GTACATTCCAATTTTAAATAGGG - Intronic
1188923095 X:36003584-36003606 AAAAATATTAATTTTAAACTAGG + Intergenic
1189568660 X:42271844-42271866 GAAAATAATAATTTTAAAAATGG - Intergenic
1190449575 X:50565096-50565118 GATAACTTTAATTTTAAATAGGG - Intergenic
1190549530 X:51564453-51564475 CAATATATTAACTTGAAATATGG - Intergenic
1190763530 X:53456570-53456592 CAACATATTCATGTAAAATAGGG + Intergenic
1190792617 X:53714137-53714159 GAACACATTATTTTGAAATGAGG - Intergenic
1190794388 X:53727310-53727332 GAACATATTACCTGTGAATAAGG + Intergenic
1190798396 X:53765810-53765832 GAAAAAATAACTTTTAAATAAGG - Intergenic
1191091178 X:56623835-56623857 AAACAGATTAGTTTTAAATAAGG - Intergenic
1191633099 X:63345596-63345618 GAACTAATTAATTCTAAGTATGG - Intergenic
1192594792 X:72395122-72395144 CAAAAGATTAATTTTAAACAAGG + Intronic
1192875640 X:75226681-75226703 GAGTACATTAATTTTAAATGTGG - Intergenic
1193424471 X:81325378-81325400 GAATGTATTTATTTTATATATGG - Intergenic
1193446281 X:81607931-81607953 GAAGATATTAATTCTAATTGAGG - Intergenic
1193539991 X:82759373-82759395 AAAAATATTAATTTTAAGTGTGG - Intergenic
1193883241 X:86952703-86952725 CAACATATTTATTTAAAATATGG - Intergenic
1193890637 X:87041766-87041788 TAACATATTAAAATTAAATATGG + Intergenic
1194017409 X:88640362-88640384 GAAGATATTACTTAGAAATAAGG - Intergenic
1194394608 X:93366744-93366766 GAAAAAATTAATTTTAAAATGGG - Intergenic
1194687679 X:96943605-96943627 GATCTTATTAATCTTAAACATGG + Intronic
1195077641 X:101342831-101342853 GAACACTTTAATACTAAATAAGG + Intergenic
1195409506 X:104554643-104554665 GAAGATGGTAATTTGAAATAGGG - Intergenic
1195412135 X:104579028-104579050 GAACATATTGTTTATAAACATGG + Intronic
1195526232 X:105893183-105893205 GAAGATATTAGTTTTAAAATAGG + Intronic
1196121469 X:112055613-112055635 TTATATATTATTTTTAAATATGG + Intronic
1196176964 X:112649030-112649052 ATACATTTTAATTTTAAATATGG - Intronic
1196675030 X:118410865-118410887 CAACATAATAATTGTAAAAAAGG - Intronic
1196716740 X:118819319-118819341 CAACATATTGTTTTTAACTATGG + Intergenic
1197032341 X:121832262-121832284 TAAGATATTAATTTCAAATTTGG - Intergenic
1198297091 X:135297642-135297664 GAATATTGTAATTTTGAATAAGG + Intronic
1198477960 X:137014005-137014027 TAACATATTAATTGAGAATAAGG + Intergenic
1199865940 X:151850149-151850171 AAATACATTAATTTTAAAAATGG + Intergenic
1200977867 Y:9231698-9231720 TATAAAATTAATTTTAAATAAGG + Intergenic
1201058605 Y:10020520-10020542 AAACATGTAAATATTAAATAGGG - Intergenic
1201338169 Y:12903134-12903156 GAATGTTTTAATTTTAAATTCGG + Intergenic
1202382353 Y:24284941-24284963 GTAGATATTAATTTTAGATATGG - Intergenic
1202488431 Y:25385184-25385206 GTAGATATTAATTTTAGATATGG + Intergenic