ID: 1015654537

View in Genome Browser
Species Human (GRCh38)
Location 6:135502439-135502461
Sequence GGTAAATGCACATCCTGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015654537_1015654539 -5 Left 1015654537 6:135502439-135502461 CCCTTACAGGATGTGCATTTACC No data
Right 1015654539 6:135502457-135502479 TTACCAATCAGAACAGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015654537 Original CRISPR GGTAAATGCACATCCTGTAA GGG (reversed) Intergenic
No off target data available for this crispr