ID: 1015657355

View in Genome Browser
Species Human (GRCh38)
Location 6:135533824-135533846
Sequence TGTAAATAGTACAGTACTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015657353_1015657355 16 Left 1015657353 6:135533785-135533807 CCTGCTTAAATACATAGATAGTA No data
Right 1015657355 6:135533824-135533846 TGTAAATAGTACAGTACTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015657355 Original CRISPR TGTAAATAGTACAGTACTAT TGG Intergenic
No off target data available for this crispr